Fermat's Library | Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors annotated/explained version.

This was a multi-institution study, and the first authors are from ...

In this paper, the authors find evidence that the bacteria Porphyro...

Periodontal disease, is an infection of the tissues that hold your ...

Here is a video from the company leading this study, Cortexyme, dis...

It is important to note the point that P. gingivalis is also found ...

P. gingivalis has been previously shown to be significantly associa...

Broad spectrum antibiotics cannot treat P. gingivalis, a motivation...

Tau is one of the main biomarkers for AD.

These key graphs demonstrate the presence of these P. gingivalis pa...

It is also important to note (as a limitation), that there is a dif...

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

1 of 21

HEALTH AND MEDICINE

Porphyromonas gingivalis in Alzheimer’s disease brains:

Evidence for disease causation and treatment with

small-molecule inhibitors

Stephen S. Dominy

†

, Casey Lynch

*, Florian Ermini

, Malgorzata Benedyk

2,3

, Agata Marczyk

Andrei Konradi

, Mai Nguyen

, Ursula Haditsch

, Debasish Raha

, Christina Griffin

Leslie J. Holsinger

, Shirin Arastu-Kapur

, Samer Kaba

, Alexander Lee

, Mark I. Ryder

Barbara Potempa

, Piotr Mydel

2,6

, Annelie Hellvard

3,6

, Karina Adamowicz

, Hatice Hasturk

7,8

Glenn D. Walker

, Eric C. Reynolds

, Richard L. M. Faull

, Maurice A. Curtis

11,12

Mike Dragunow

11,13

, Jan Potempa

2,5

Porphyromonas gingivalis, the keystone pathogen in chronic periodontitis, was identified in the brain of Alzheimer’s

disease patients. Toxic proteases from the bacterium called gingipains were also identified in the brain of Alzheimer’s

patients, and levels correlated with tau and ubiquitin pathology. Oral P. gingivalis infection in mice resulted in

brain colonization and increased production of A

1–42

, a component of amyloid plaques. Further, gingipains were

neurotoxic in vivo and in vitro, exerting detrimental effects on tau, a protein needed for normal neuronal func-

tion. To block this neurotoxicity, we designed and synthesized small-molecule inhibitors targeting gingipains.

Gingipain inhibition reduced the bacterial load of an established P. gingivalis brain infection, blocked A

1–42

pro-

duction, reduced neuroinflammation, and rescued neurons in the hippocampus. These data suggest that gin-

gipain inhibitors could be valuable for treating P. gingivalis brain colonization and neurodegeneration in

Alzheimer’s disease.

INTRODUCTION

Alzheimer’s disease (AD) patients exhibit neuroinflammation con-

sistent with infection, including microglial activation, inflammasome

activation, complement activation, and altered cytokine profiles

(1,2). Infectious agents have been found in the brain and postulated

to be involved with AD, but robust evidence of causation has not

been established (3). The recent characterization of amyloid- (A)

as an antimicrobial peptide has renewed interest in identifying a

possible infectious cause of AD (4–6).

Chronic periodontitis (CP) and infection with Porphyromonas

gingivalis—a keystone pathogen in the development of CP (7)—

have been identified as significant risk factors for developing A

plaques, dementia, and AD (8–12). A prospective observational

study of AD patients with active CP reported a notable decline in

cognition (Alzheimer’s Disease Assessment Scale—Cognitive and

Mini Mental State Examination scales) over a 6-month period com-

pared to AD patients without active CP, raising questions about

possible mechanisms underlying these findings (13). In Apoe

−/−

mice,

oral infection with P. gingivalis, but not with two other oral bacteria,

results in brain infection and activation of the complement pathway

(14). In transgenic mice overexpressing mutated human amyloid

precursor protein (hAPP-J20), oral infection with P. gingivalis

impairs cognitive function, increases the deposition of AD-like

plaques, and results in alveolar bone loss compared to control

hAPP-J20 mice (15). P. gingivalis lipopolysaccharide has been detected

in human AD brains (16), promoting the hypothesis that P. gingivalis

infection of the brain plays a role in AD pathogenesis (17).

P. gingivalis is mainly found during gingival and periodontal in-

fections; however, it can also be found at low levels in 25% of healthy

individuals with no oral disease (18). Transient bacteremia of P. gingivalis

can occur during common activities such as brushing, flossing, and

chewing, as well as during dental procedures (19), resulting in docu-

mented translocation to a variety of tissues including coronary ar-

teries (20), placenta (21), and liver (22). A recent study found that

100% of patients with cardiovascular disease had P. gingivalis arte-

rial colonization (23).

P. gingivalis is an asaccharolytic Gram-negative anaerobic bacte-

rium that produces major virulence factors known as gingipains,

which are cysteine proteases consisting of lysine-gingipain (Kgp),

arginine-gingipain A (RgpA), and arginine-gingipain B (RgpB).

Gingipains are secreted, transported to outer bacterial membrane

surfaces, and partially released into the extracellular milieu in solu-

ble and outer membrane vesicle (OMV)–associated forms (24,25).

Kgp and RgpA/B are essential for P. gingivalis survival and pathoge-

nicity, playing critical roles in host colonization, inactivation of host

defenses, iron and nutrient acquisition, and tissue destruction (24,26).

Gingipains have been shown to mediate the toxicity of P. gingivalis

Cortexyme, Inc., 269 East Grand Ave., South San Francisco, CA, USA.

Department

of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian

University, Krakow, Poland.

Malopolska Centre of Biotechnology, Jagiellonian Uni-

versity, Krakow, Poland.

Division of Periodontology, Department of Orofacial Sci-

ences, University of California, San Francisco, San Francisco, CA, USA.

Department

of Oral Immunology and Infectious Diseases, University of Louisville School of Den-

tistry, Louisville, KY, USA.

Broegelman Research Laboratory, Department of Clinical

Science, University of Bergen, Bergen, Norway.

The Forsyth Institute, Cambridge,

MA, USA.

Harvard University School of Dental Medicine, Boston, MA, USA.

Coopera-

tive Research Centre for Oral Health Science, Melbourne Dental School and the Bio21

Institute of Molecular Science and Biotechnology, University of Melbourne, Melbourne,

Victoria, Australia.

Department of Anatomy with Radiology, Centre for Brain Research

and NeuroValida, Faculty of Medical and Health Sciences, University of Auckland,

Auckland, New Zealand.

Centre for Brain Research and NeuroValida, Faculty of Medi-

cal and Health Sciences, University of Auckland, Auckland, New Zealand.

Department

of Anatomy and Medical Imaging, Faculty of Medical and Health Sciences, Univer-

sity of Auckland, Auckland, New Zealand.

Department of Pharmacology, Faculty

of Medical and Health Sciences, University of Auckland, Auckland, New Zealand.

*These authors contributed equally to this work as co-senior authors.

†Corresponding author. Email: sdominy@cortexyme.com

The Authors, some

rights reserved;

exclusive licensee

American Association

for the Advancement

of Science. No claim to

original U.S. Government

Works. Distributed

under a Creative

Commons Attribution

License 4.0 (CC BY).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

2 of 21

in endothelial cells, fibroblasts, and epithelial cells (27–29). More-

over, because treatment with broad-spectrum antibiotics rarely

eradicates P. gingivalis and may lead to resistance (30), gingipains

are implicated as narrow-spectrum virulence targets (24,31–33).

Blocking gingipain proteolytic activity with short peptide analogs

reduces P. gingivalis virulence (34).

We hypothesized that P. gingivalis infection acts in AD patho-

genesis through the secretion of gingipains to promote neuronal

damage. We found that gingipain immunoreactivity (IR) in AD

brains was significantly greater than in brains of non-AD control

individuals. In addition, we identified P. gingivalis DNA in AD

brains and the cerebrospinal fluid (CSF) of living subjects diag-

nosed with probable AD, suggesting that CSF P. gingivalis DNA

may serve as a differential diagnostic marker. We developed and

tested potent, selective, brain-penetrant, small-molecule gingipain

inhibitors in vivo. Our results indicate that small-molecule inhibi-

tion of gingipains has the potential to be disease modifying in AD.

AD diagnosis correlates with gingipain load in brain

Tissue microarrays (TMAs) containing sex- and age-matched brain

tissue cores from the middle temporal gyrus (MTG) of both AD

patients and neurologically normal individuals were used for im-

munohistochemical (IHC) studies (tables S1 and S2). Gingipain-

specific antibodies, CAB101 and CAB102, targeting RgpB and Kgp,

respectively, were used to determine gingipain load in brain tissue

cores. Tau load in the TMAs was measured using an antibody

(DAKO A0024) that recognizes both nonphosphorylated and phos-

phorylated tau. RgpB and Kgp exhibited punctate intraneuronal

staining in tissue from AD brains (Fig.1,AandB, respectively). On

the basis of threshold analysis (see Materials and Methods), 96% (51

of 53) of AD samples were positive for RgpB and 91% (49 of 54) of

AD samples were positive for Kgp. The RgpB load was significantly

higher in AD brains than in nondemented control brains (Fig.1C),

and similarly, the Kgp load was significantly higher in AD brains

compared to nondemented control brains (Fig.1D).

We next stained for tau and found a highly significant correla-

tion between RgpB load and tau load (Fig.1E) and Kgp load and tau

load (Fig.1F). Tau pathology has been shown to correlate with cog-

nitive impairment in AD (35). We next stained the TMAs for ubiq-

uitin, a small protein tag that marks damaged proteins for degradation

by proteasomes (36) and accumulates in both tau tangles and A

plaques (37). There was a significant correlation between RgpB

load and ubiquitin load (Fig.1G) and Kgp load and ubiquitin load

(Fig.1H) in the TMAs. Of note, in nondemented control tissues, RgpB

staining was observed in 39% (18 of 46) of samples and Kgp staining

was observed in 52% (26 of 50) of samples. The correlation analyses

between the gingipain load and tau load (Fig.1,EandF) and between

the gingipain and ubiquitin load (Fig.1,GandH) in the nondemented

control samples revealed a continuum of gingipain and AD pathology

already present in the controls. These findings are consistent with

the concept of preclinical AD, i.e., the stage of disease when patho-

genesis has begun, but clinical symptoms are not yet present (38).

To further validate the gingipain IHC in the TMAs, we per-

formed a correlation analyses between the RgpB load and Kgp load

and found a significant correlation between the two different anti-

gens (Fig.1I). As a further IHC control, brain TMAs from several

different non-AD neurological diseases were probed with the CAB101

antibody. RgpB immunostaining on MTG TMAs of Parkinson’s

disease, Huntington’s disease, and amyotrophic lateral sclerosis re-

vealed no significant differences compared to controls (fig. S1). In

summary, both RgpB and Kgp antigens in brain independently

demonstrated a significant correlation with AD diagnosis, tau load,

and ubiquitin load.

RgpB colocalizes with neurons, astrocytes, and pathology in

AD hippocampus

In AD, the hippocampus is one of the first brain areas to be damaged.

Using a different antibody for RgpB than CAB101 (18E6 monoclonal;

see Materials and Methods), RgpB-IR was confirmed in neurons of

the dentate gyrus and CA3, CA2, and CA1 of AD hippocampus with

brightfield microscopy (Fig.2A). IHC analysis of a series of brains

from a university brain bank revealed a similar pattern of staining

for RgpB (fig. S2). Using immunofluorescence, RgpB-IR (CAB101)

colocalized primarily with neurons [microtubule-associated protein 2

(MAP2)] (Fig.2C) as well as occasional astrocytes, but not with

microglia (Iba1) (Fig.2D). In addition, RgpB colocalized with

pathology including tau tangles and intraneuronal A (Fig.2E).

Detection of Kgp in AD cerebral cortex

AD is also associated with atrophy of the gray matter of the cerebral

cortex. Brain lysates from the cerebral cortex of three AD brains

and six nondemented control brains were immunoprecipitated (IP)

with CAB102 and run on a Western blot (WB) (Fig.3B). The

CAB102 polyclonal antibody recognizes amino acids 22 to 400 of

Kgp, covering the propeptide and the N-terminal region of the cat-

alytic domain (see Materials and Methods). The WB from all three

AD brains revealed similar Kgp bands of molecular weights corre-

sponding to the molecular weights of Kgp bands from bacterial ly-

sates from P. gingivalis strains W83, ATCC33277, and FDC381

(Fig.3A). Strain HG66, which contains a mutation affecting the re-

tention of gingipains on its cell surface (39), demonstrated only a

single Kgp band at the molecular weight of the Kgp catalytic domain

(Fig.3A). The Kgp catalytic domain was identified at the proper mo-

lecular weight (40) in all of the AD brain samples (Fig.3B). In

addition, five of the six nondemented control brains demonstrated

Kgp banding patterns similar to the AD brains (Fig.3B), consistent

with our IHC data demonstrating a continuum of gingipain and AD

pathology present in nondemented control brains (Fig.1,D,F,andH).

In the sixth nondemented control brain sample (C6), the Kgp bands

were very faint, indicating near absence of Kgp (Fig.3B).

Identification of the P. gingivalis 16S rRNA and hmuY genes

in AD cerebral cortex

To further validate the Kgp protein detection data, we performed

quantitative polymerase chain reaction (qPCR) analysis on DNA

isolated from the same brain tissue used for the Kgp IP and WB

analysis. qPCR analysis using P. gingivalis 16S rRNA primers re-

vealed the presence of the P. gingivalis 16S rRNA gene in the AD

brains and five of the six nondemented control brains (Fig.3C).

Control brain C6, which exhibited near absence of Kgp bands in

Fig.3B above, was negative by qPCR for the P. gingivalis 16S rRNA

gene (Fig.3C). To further validate the 16S rRNA qPCR results, we

performed PCR analysis using primers for the hmuY gene, a gene

highly specific for P. gingivalis (41). All three AD brains and the five

nondemented control brains that were positive for the 16S rRNA

gene were also positive for the hmuY gene, and sequencing of the

hmuY PCR products confirmed the presence of P. gingivalis in brain

DNA (fig. S3). Because we were using a highly sensitive PCR method

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

3 of 21

to detect low copy numbers of P. gingivalis DNA (see Materials and

Methods), we were concerned that nested amplification of a common

Gram-negative bacterium such as P. gingivalis in the presence of brain

DNA could be creating a false-positive signal. Therefore, as an ad-

ditional negative control, we used the same nested primer method

to attempt to detect another ubiquitous Gram-negative bacterium,

Helicobacter pylori (see Materials and Methods) (42). We tested the

three AD brain DNA samples and three of the P. gingivalis–positive

nondemented brain DNA samples for H. pylori. All six brain sam-

ples were negative for H. pylori using validated qPCR primers and

probe (fig. S3D) (43), indicating that our P. gingivalis PCR results

are not likely due to a PCR artifact. In summary, the identification

of P. gingivalis DNA in AD brains and Kgp-positive nondemented

control brains further validates the identification of Kgp in the same

brain tissue samples by IP and WB.

P. gingivalis DNA is present in the CSF of clinical AD patients

CSF is considered a “window” into brain infection, providing in-

sight into the neuropathogenesis of infectious agents (44). Hence,

we conducted a prospective pilot study using CSF collected from

Control

Fig. 1. Gingipain IR in brain correlates with AD diagnosis and pathology. (A and B) Representative TMA NVD005 containing brain tissue cores from the MTG of AD

patients and controls probed for RgpB (A) and Kgp (B) with antibodies CAB101 and CAB102, respectively. Higher magnification of representative tissue cores reveals

higher neuronal RgpB-IR and Kgp-IR in AD tissue cores than in control cores. (C) RgpB-IR and (D) Kgp-IR data from TMAs NVD005 and NVD003 show significantly higher load

in AD brain compared to controls. Mann-Whitney test, ***P < 0.0001; presented as geometric mean ± 95% confidence interval, n = 99 (C) and n = 104 (D). (E and F) Tau

load correlates to RgpB load (Spearman r = 0.674, P < 0.0001, n = 84) (E) and Kgp load (Spearman r = 0.563, P < 0.0001, n = 89) (F). Blue, control; red, AD. (G and H) Ubiquitin

load, a marker of AD pathology, correlates to RgpB load (blue, control; red, AD; Spearman r = 0.786, P < 0.0001, n = 99) (G) and Kgp load (Spearman r = 0.572, P < 0.0001,

n = 104) (H). (I) RgpB load correlates with Kgp load (Spearman r = 0.610, P < 0.0001, n = 99).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

4 of 21

10 patients diagnosed with probable AD who had mild to moderate

cognitive impairment (Fig.4D). CSF and matched saliva samples

were collected and analyzed for P. gingivalis DNA by qPCR detec-

tion of the hmuY gene (41). Positive and negative controls, similar

to the standard of care for detection of other brain infections in CSF,

were used (45,46). We were able to detect and quantify copies of the

hmuY gene by qPCR in CSF in 7 of the 10 clinically diagnosed AD

patients, with P. gingivalis load ranging from 10 to 50 copies/l of

CSF (Fig.4A), and the relative fluorescence intensity of the qPCR

products on agarose gel was consistent with the qPCR data (Fig.4C).

Sequencing of the endpoint PCR products from CSF confirmed the

presence of the hmuY gene (fig. S4). We then quantified the P. gingivalis

load in the matching saliva samples from all 10 patients. All 10 match-

ing saliva samples were positive for P. gingivalis by qPCR assay of

the hmuY gene (Fig.4B). As with the brain samples noted above, for

a PCR-negative control, we analyzed CSF samples for the presence of

H. pylori using methods with the same sensitivity as for P. gingivalis.

All of the CSF samples were negative for H. pylori (Fig.4C). The

CSF data provide additional evidence for P. gingivalis infection in

the brain of AD patients.

Fig. 2. RgpB colocalizes with neurons and pathology in AD hippocampus. (A) IHC using RgpB-specific monoclonal antibody 18E6 (representative images from a

63-year-old AD patient). The hippocampus shows abundant intracellular RgpB in the hilus (1), CA3 pyramidal layer (2), granular cell layer (3), and molecular layer (4).

High-magnification images from the indicated areas (1 to 4) exhibit a granular staining pattern consistent with P. gingivalis intracellular infection. Scale bars, 200 m

(overview), 50 m (1), and 10 m (2 to 4). (B) AD hippocampus stained with 18E6 (AD) compared to gingival tissue (gingiva) from a patient with periodontal disease as well as a

non-AD control and mouse IgG1 control (IgG1) in an adjacent hippocampal section. Scale bars, 50 m. (C) Immunofluorescent colabeling with CAB101 reveals granular

intraneuronal staining for RgpB (arrows) in MAP2-positive neurons in both the granular cell layer (GCL) and the pyramidal cell layer (CA1). Scale bars, 10 m. (D) Dense extra-

cellular RgpB-positive aggregates (arrowheads) were closely associated with astrocytes [glial fibrillary acidic protein (GFAP)]. There was no observed association of RgpB with

microglia (IBA1). Scale bars, 10 m. (E) RgpB was associated with paired helical filament Tau (PHF-Tau; arrows). RgpB-positive neurons negative for PHF-Tau (arrowheads)

were also seen. Intracellular A was often colocalized with RgpB (arrows). In some A-positive cells, RgpB could not be detected (arrowheads). Scale bars, 10 m.

Fig. 3. Identification of P. gingivalis–specific protein and DNA in cortex from control and AD patients. (A) WB with four different strains of P. gingivalis and CAB102

detection of typical molecular weight bands for Kgp in bacterial lysates. (B) IP using brain lysates from nondemented controls (C1 to C6; ages 75, 54, 63, 45, 37, and 102 years,

respectively) and AD patients (AD1 to AD3; ages 83, 90, and 80 years, respectively) using CAB102 with subsequent WB reveals the ~50-kDa Kgp catalytic subunit (Kgp

cat

along with higher– and lower–molecular weight Kgp species seen in (A). (C) qPCR from DNA isolated from the same brain lysates as the protein samples analyzed in (B)

shows a positive signal in nondemented control (C1 to C5) and AD (AD1 to AD3) samples. Sample C6 from the 102-year-old nondemented control patient had no detect-

able qPCR signal in (C) and very faint bands indicating near absence of Kgp (B) (mean with SEM error bars of repeat qPCR runs).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

5 of 21

Tau is fragmented by gingipains

Because we identified colocalization of gingipain with tau tangles in

AD brain (Fig.2E), we were interested to see whether tau was a target

for gingipain proteolysis. Tau truncation and fragmentation have

been proposed to play a key role in inducing the formation of insol-

uble and hyperphosphorylated tau in AD (47–49). To determine

whether gingipains cleave tau in a cell-based system, we used SH-

SY5Y cells that express high–molecular weight forms of tau (50).

Using the Tau-5 antibody as a probe, SH-SY5Y cells infected

with three different concentrations of P. gingivalis were examined at

three different time points. The results showed a dose-dependent

loss of soluble total tau within 1 hour of infection compared to unin-

fected cells, while cells infected with P. gingivalis gingipain–defective

mutants showed soluble tau levels similar to uninfected cells, indi-

cating that gingipains were responsible for the loss of the Tau-5 epitope

(Fig.5,AandB).

To characterize gingipain cleavage sites within tau, we incubated

recombinant tau-441 with purified protein containing the catalytic

domains of both Kgp and RgpB in combination and identified tau

cleavage fragments by mass spectrometry (MS). Following exposure

to 1 nM purified gingipains, we identified tau fragments covering

23% of the tau-441 amino acid sequence; at 10 nM gingipains, tau

fragments were generated covering 85% of the tau sequence (Fig.5D

and table S3). From the identified tau fragments, we were able to

deduce 14 RgpB cleavage sites and 30 Kgp cleavage sites within the

tau-441 protein (Fig.5D). Most of the Kgp cleavage sites (21 of 30)

were located C-terminal to position 222 in the tau protein. For RgpB,

the majority of cleavage sites (9 of 14) were located N-terminal to

position 222. Within the Tau-5 antibody epitope, which spans resi-

dues 210 to 230 in tau-441, we identified two RgpB cleavage sites

and two Kgp cleavage sites (Fig.5D,b). Thus, gingipain cleavages

within the Tau-5 antibody epitope were the likely cause of the loss

of the Tau-5 antibody signal and therefore tau protein detection af-

ter SH-SY5Y cells were infected with P. gingivalis.

We identified a mid-domain, RgpB-generated tau peptide fragment,

TPSLPTPPTR (residues 212 to 221), which is part of the Tau-5 epitope

(Fig.5D,g). This tau peptide is common to all tau isoforms and has

been used as an analyte to measure tau levels in CSF (51) and deter-

mine the turnover rate of tau in the human central nervous system

(CNS) (52). The TPSLPTPPTR fragment has been reported to be

increased 1.7-fold in AD CSF compared to non-AD CSF (51).

Kgp generated four unique tau peptide fragments containing the

hexapeptide sequence VQIVYK (Fig.5D,e) and two unique tau pep-

tide fragments containing the VQIINK sequence (Fig.5D,f). Tau

fragments containing these hexapeptide motifs have been shown to

be involved in tau tangle formation by nucleating paired helical fil-

aments (PHFs) from full-length tau (53,54).

Small-molecule gingipain inhibitors are neuroprotective

To determine whether gingipains are toxic to neurons in vitro, we ex-

posed differentiated SH-SY5Y cells to either RgpB or Kgp for 24 hours.

Combined application of RgpB and Kgp significantly increased cell

aggregation (Fig.6A). Pretreatment of gingipains with iodoacetamide,

an irreversible cysteine protease inhibitor, prevented gingipain-induced

aggregation, indicating that the proteolytic activity of the gingipains

was responsible for the morphological changes (Fig.6A).

On the basis of the cytotoxic activity of gingipains from P. gingivalis,

their presence in AD brain, and their critical role in bacterial survival

and virulence, we developed a library of potent and selective reversible

and irreversible small-molecule gingipain inhibitors. COR286 and

()

Fig. 4. Detection of P. gingivalis in CSF and oral biofluids from clinical AD subjects. (A) Detection and quantitation of P. gingivalis DNA by qPCR in CSF from subjects

with probable AD. (B) Detection and quantitation of P. gingivalis DNA by qPCR from matching saliva samples. (C) Top: PCR products detecting P. gingivalis from CSF in (A)

from all subjects run on agarose gel including negative and positive controls containing a synthetic DNA template. Faint or undetectable PCR products from subjects AD1,

AD3, and AD5 were below the limit of quantitation for copy number and not of sufficient quantity for sequence analysis. Bottom: qPCR products from CSF from the same

subjects for H. pylori. (D) Data table includes age and Mini Mental Status Exam (MMSE) score on subjects and sequence identity of PCR products to P. gingivalis hmuY DNA

sequence. Sequence data are included in fig. S4. NS, not sequenced.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

6 of 21

COR271 are irreversible inhibitors of arginine-specific (RgpA and

RgpB) and lysine-specific (Kgp) gingipains, respectively, both with

a median inhibitory concentration (IC

) of <50 pM. COR119 is a

reversible covalent Kgp inhibitor with an IC

of 10 nM.

To quantify protective effects of gingipain inhibitors, we infected

SH-SY5Y cells with the W83 strain of P. gingivalis at a multiplicity of

infection (MOI) of 400 for 48 hours, producing approximately 50%

cell death (Fig.6B). COR286 and COR271 were both effective in block-

ing P. gingivalis–induced cell death in a concentration-dependent

manner (Fig.6B). Broad-spectrum antibiotics, moxifloxacin and doxy-

cycline, even at concentrations that reduce bacterial survival in vitro

(55), did not protect the cells. We also tested the -secretase inhibitor

semagacestat (LY450139), which blocks the formation of A

1–42

(56),

to determine whether bacterial toxicity was mediated by P. gingivalis–

induced A production, but it had no protective effect (Fig.6B).

We next assessed whether gingipains are neurotoxic in vivo and

whether inhibitors can penetrate the brain and prevent gingipain neu-

rotoxicity. Eight-week-old BALB/c mice were given a single adminis-

tration of gingipain inhibitors via a combination of COR271 by oral

gavage and COR286 subcutaneously, or both vehicles. Stereotactic in-

jection of a combination of Kgp and RgpB into the hippocampus was

performed 1.5 hours later. Seven days later, brains were analyzed for

neurodegeneration. Mice injected with gingipains had a significantly

greater number of degenerating neurons than saline-injected mice, but

the neurodegeneration could be blocked by pretreatment with a com-

bination of gingipain inhibitors COR286 and COR271 (Fig.6,CandD).

Oral infection of mice with P. gingivalis results in brain

infection and induction of A

1–42

We next wanted to understand whether oral exposure to P. gingivalis

would result in brain infiltration and induction of the stereotypical

AD marker A

1–42

. Aged 44-week-old BALB/c mice were orally in-

fected every other day over 6 weeks with P. gingivalis W83, Kgp knock-

out (Kgp) [kgp (602–1732) Em

] (57), or RgpA RgpB double

knockout (Rgp) (rgpA rgpB495-B Cm

, Em

) (58) P. gingivalis.

One W83-infected arm was administered the Kgp inhibitor COR119

three times per day subcutaneously over days 21 to 42. Endpoint PCR

analysis of mouse brains for P. gingivalis revealed that the bacteria

invaded the brain of all eight mice after oral infection for 6 weeks,

and colonization was decreased by gingipain knockout strains or treat-

ment with COR119 (Fig.7A). Mouse brain A

1–42

increased signifi-

cantly after oral infection with P. gingivalis compared to mock-infected

or COR119-treated mice (Fig.7B). Mice infected with Rgp or Kgp

strains of P. gingivalis had brain A

1–42

levels no different than mock-

infected, indicating that both gingipains were needed, either directly

or indirectly, to induce an A

1–42

response in vivo (Fig.7B).

A

1–42

has antibacterial effects against P. gingivalis

The significant A

1–42

response in the mouse brain to P. gingivalis

infection is consistent with reports demonstrating that A

1–42

is an

antimicrobial peptide (4,6). We therefore assayed whether A

1–42

interacts with P. gingivalis and decreases its viability in vitro. After

incubation of A

1–42

with P. gingivalis, A

1–42

colocalized with RgpB

on the surface of the bacterium (Fig.7C). Because A

1–42

is known

to disrupt cellular membranes, we hypothesized that A

1–42

might

disrupt the integrity of the P. gingivalis membrane to cause cell death.

In a separate experiment, we used an assay that can detect damaged

bacterial membranes and quantitate the amount of dead or dying

bacterial cells as a result of membrane damage. We found that the

proportion of dead and dying P. gingivalis bacterium significantly

increased after incubation with A

1–42

when compared to A

1–40

A

1–42

scrambled, and phosphate-buffered saline (PBS; Fig.7D).

Fig. 5. P. gingivalis and gingipains fragment tau. (A) WB analysis of total soluble tau in SH-SY5Y cells infected with increasing concentrations of wild-type (WT)

P. gingivalis strain W83 (P.g.) and P. gingivalis gingipain-deficient mutants either lacking Kgp activity (KgpIg-B) or lacking both Kgp and Rgp activity (K/RAB-A). Un-

infected SH-SY5Y cells (No P.g.) were used as a negative control. Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as a loading control. Total tau was moni-

tored with the monoclonal antibody Tau-5 at 1, 4, and 8 hours after infection. (B) Densitometry analysis of the total tau WB images. (C) WB analysis of rtau-441 incubated

with purified Kgp and RgpB catalytic domains combined (Gp) at various concentrations for 1 hour at 37°C. The blot was probed with tau monoclonal antibody T46.

(D) Gingipain cleavage sites in rtau-441 deduced from peptide fragments identified by MS for rtau-441 incubated with 1 or 10 nM gingipains. (a) T46 antibody epitope

(red). (b) Tau-5 antibody epitope (red). (c) N-terminal tau fragment. (d) C-terminal tau fragment. (e) Kgp-generated tau fragments containing the VQIVYK sequence.

(f ) Kgp-generated fragments containing the VQIINK sequence. (g) An RgpB-generated tau fragment. *Cleavage sites identified at 1 nM gingipains.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

7 of 21

Oral administration of a Kgp inhibitor effectively treats

P. gingivalis brain infection and prevents loss of

hippocampal Gad67

interneurons in vivo

We next wanted to measure the effects of gingipain inhibitors on

P. gingivalis load in the brain after oral infection of BALB/c mice. Eight-

week-old mice were orally infected every other day for 42 days with

P. gingivalis W83 [10

colony-forming units (CFU)] and were given

28 days of rest before study completion. Treatment, beginning after

brain infection was established, was administered during days 36 to

70 (Fig.7E). P. gingivalis DNA was identified by qPCR in the brain

of all infected mice at day 35, and copies of the P. gingivalis genome

significantly increased by day 70 (Fig.7F). The Kgp inhibitor COR271,

which has oral bioavailability and significant CNS penetration, ad-

ministered orally twice a day significantly reduced bacterial load in

the brain compared to the positive control infection arm and in com-

parison to baseline levels at 5 weeks (Fig.7F). The RgpB inhibitor

COR286, administered subcutaneously, was effective in reducing the

brain bacterial load at 10 weeks, but was not as effective as COR271

in reducing the bacterial load below baseline at 5 weeks (Fig.7F). The

broad-spectrum antibiotic moxifloxacin was also beneficial in pre-

venting the increase in brain colonization between day 35 and day 70

but was not effective in reducing the P. gingivalis load below the 5-week

baseline (Fig.7F). Combinations of COR271 with moxifloxacin or

COR286 did not improve efficacy over COR271 alone (Fig.7F).

Histological analysis of brains after the completion of the 10-week

study revealed a significant loss of Gad67

GABAergic interneurons

in the hippocampal dentate gyrus in the P. gingivalis infection group

compared to mock infection (Fig.7G). In AD, brain neuroimaging

and postmortem studies have shown variable disruption of the hip-

pocampal GABAergic system (59). Treatment with the Kgp inhibitor

COR271 alone, the RgpB inhibitor COR286 alone, a combination of

COR271 and COR286, COR271 plus moxifloxacin, and moxifloxacin

Fig. 6. Small-molecule gingipain inhibitors protect neuronal cells against P. gingivalis– and gingipain-induced toxicity in vitro and in vivo. (A) Differentiated SH-

SY5Y neuroblastoma cells demonstrate cell aggregation after exposure to RgpB (10 g/ml), Kgp (10 g/ml), or both for 24 hours. The nonselective cysteine protease in-

hibitor iodoacetamide (IAM) blocks the gingipain-induced cell aggregation. (B) AlamarBlue viability assay shows that P. gingivalis (P.g.) is toxic to SH-SY5Y cells (MOI of

400) and that the small-molecule Kgp inhibitor COR271 and the RgpB inhibitor COR286 provide dose-dependent protection. The broad-spectrum antibiotics moxifloxa-

cin and doxycycline and the -secretase inhibitor semagacestat did not inhibit the cytotoxic effect of P. gingivalis. (C) Fluoro-Jade C (FJC) staining (green) in pyramidal

neurons of the CA1 region of the mouse hippocampus indicates neurodegeneration after stereotactic injection of gingipains. Counterstain with 4′,6-diamidino-2-phenylindole

(DAPI) (blue). Scale bars, 50 m. (D) The total number of FJC-positive cells was determined from serial section through the entire hippocampus. Results demonstrate a

significant neuroprotective effect of gingipain inhibitors COR271 + COR286 after acute gingipain exposure in the hippocampus (*P < 0.05, n = 14). All graphs show the

mean with SEM error bars.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

8 of 21

( )

−

Fig. 7. P. gingivalis invasion of the brain induces an A

1–42

response that is blocked by gingipain inhibition in mice. (A) P. gingivalis PCR product in mouse brains

after oral infection with P. gingivalis W83, with or without treatment with the Kgp inhibitor COR119, or infection with gingipain knockout strain RgpB or Kgp. Lanes 1

to 8 represent individual experimental animals. In the first lane (P.g.), P. gingivalis W83 was used as a positive control. (B) P. gingivalis W83–infected mice, but not COR119-

treated mice or mice infected with gingipain knockouts, had significantly higher A

1–42

levels compared to mock-infected mice (***P < 0.001, n = 40). (C) RgpB-IR (red)

colocalized with A

1–42

-IR (green) on the surface of P. gingivalis (D) A

1–42

, but not A

1–40

or A

1–42

scrambled, decreased viability of P. gingivalis (***P < 0.001, n = 12).

(E) Study design to quantitate the effect of gingipain inhibitors on brain P. gingivalis load. (F) qPCR results showed a substantial P. gingivalis copy number in the brain at

5 weeks, increasing 10-fold at 10 weeks (Inf. 10 week). All treatment groups showed a significant decrease in P. gingivalis load compared to vehicle-treated Inf. 10 week

mice (***P < 0.0001, n = 63). Treatment with the Kgp inhibitor COR271 resulted in a 90% reduction of P. gingivalis copy number. Comparing treatment groups to baseline

infection at the beginning of treatment (Inf. 5 week) showed a significant reduction with COR271 and COR286 (

P < 0.01,

P < 0.05) but not with moxifloxacin. (G) The

number of Gad67

interneurons in the dentate gyrus of the hippocampus was significantly decreased in the Inf. 10 week group (*P < 0.05, n = 120). This decrease was

reduced in all treatment groups, with COR271 and COR286 trending to better protection than moxifloxacin. (F) Geometric mean with 95% confidence interval. (B), (D),

and (G) show the mean with SEM error bars.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

9 of 21

alone, all beginning at day 36, reduced loss of the Gad67

interneu-

rons, with moxifloxacin-treated arms trending to decreased protec-

tion (Fig.7G).

COR388 treatment shows dose-dependent effects on brain

P. gingivalis infection, A

1–42

, and tumor necrosis factor–

levels in mice

On the basis of the superior performance of the highly potent and

specific Kgp inhibitor COR271 in the above in vivo mouse study in

clearing P. gingivalis brain infection and protecting Gad67

neurons

in the hippocampus compared to an Rgp inhibitor and a broad-

spectrum antibiotic, we developed the COR271 analog COR388.

Similar to COR271, COR388 is a highly potent (picomolar inhibi-

tion constant on Kgp) and selective irreversible small-molecule inhibi-

tor of Kgp, with superior oral pharmacokinetic and drug- appropriate

properties including significant CNS penetration.

In parallel, we also developed Kgp activity–based probes to

characterize COR388 Kgp target engagement in intact P. gingivalis

bacteria and biological tissue samples. We developed the fluores-

cent activity probe COR553 by combining a potent, small-molecule

irreversible Kgp inhibitor with Cy5 (Fig.8A) and validated its spec-

ificity and potency on Kgp in vitro (Fig.8,BtoD). COR553 bound

Kgp present in bacterial cultures of P. gingivalis but did not bind a

strain deficient in Kgp (Fig.8B). Preincubation of bacterial lysate

with Kgp antibody CAB102 depleted Kgp protein and COR553

binding from the lysate, while CAB102 antibody–bound complexes

contain Kgp and COR553 binding, confirming the identity of the

COR553 target (Fig.8C). Preincubation of P. gingivalis with 100 nM

COR388 before COR553 binding resulted in COR388 engagement

with the Kgp active site and a block of COR553 activity probe bind-

ing (Fig.8D). Using the COR553 probe, we demonstrated COR388

Kgp target engagement ex vivo in human oral subgingival plaque

samples obtained from patients with periodontal disease (table S4).

COR553 labeled Kgp present in plaque in four of the five sub-

jects. Preincubation with COR388 blocked probe binding to the

active site, while total Kgp protein was still detected by CAB102

(Fig.8E). High levels of Kgp in these plaque samples mirrored

detection of P. gingivalis DNA in the plaque samples (Fig.8F).

These same four subjects also had detectable levels of P. gingivalis in

saliva (Fig.8G).

HI JKL

BC D

Fig. 8. COR388 target engagement and dose-dependent effects on brain P. gingivalis, A

1–42

, and TNF in mice. (A) COR553 fluorescent activity probe for Kgp.

(B) COR553 labeling of Kgp in P. gingivalis W83 strain and no labeling in mutant deficient in Kgp (Kgp). (C) W83 lysates labeled with COR553. Left lane, before immuno-

depletion; middle lane, after immunodepletion with anti-Kgp–conjugated beads; right lane, after elution from anti-Kgp–conjugated beads. (D) W83 strain titrated and

labeled with COR553 to determine the limit of bacterial detection. See Results for details. (E) Oral plaque samples from human subjects (CB1-5) with periodontal disease

were incubated ex vivo with COR553 probe with or without preincubation with COR388. COR553 probe and CAB102 detected Kgp strongly in three subjects (CB1, CB4,

and CB5) and weakly in one subject (CB3). COR388 preincubation blocked COR553 probe binding to Kgp. (F) qPCR analysis of plaque samples using hmuY gene–specific

primers identified P. gingivalis DNA in samples. (G) qPCR analysis of saliva samples. The bar graphs in (F) and (G) show the means and SEMs of three replicates. (H) COR388

treatment of W83 culture in defined growth medium reduced growth similarly to a Kgp-deficient strain (Kgp) over 43 hours. (I) Resistance developed rapidly to moxi-

floxacin but not COR388 with repeat passaging of bacterial culture. (J to L) Efficacy of COR388 at three oral doses of 3, 10, and 30 mg/kg twice daily in treating an estab-

lished P. gingivalis brain infection in mice. Reduction of brain tissue levels of P. gingivalis (J), A

1–42

(K), and TNF (L). The bar graphs show the means with SEM error bars.

***P < 0.001, **P < 0.01, *P < 0.05, t test with Dunn’s multiple comparison correction; n = 39.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

10 of 21

Using a defined growth medium, we showed that COR388 in-

hibited the growth of P. gingivalis, demonstrating that an inhibitor

of the Kgp virulence factor involved in generating nutrient amino

acids for energy acts as a narrow-spectrum antibiotic (Fig.8H). To

test for the potential for resistance to COR388, P. gingivalis was pas-

saged in the presence of COR388 or the broad-spectrum antibiotic

moxifloxacin. As shown in Fig.8I, P. gingivalis developed complete

resistance to moxifloxacin, with the minimum inhibitory concentra-

tion (MIC) increasing over 1000-fold in 12 passages. Resistance to

COR388 in two independent assays did not develop in this study. Effi-

cacy of COR388 was tested in vivo to treat an established P. gingivalis

brain infection in the mouse model described above for COR271

efficacy testing (Fig.7E). Similar to COR271, oral dosing of COR388

twice daily resulted in dose-dependent efficacy when administered to

an established P. gingivalis brain infection. Doses of 10 and 30 mg/kg

reduced P. gingivalis load, A

1–42

, and tumor necrosis factor– (TNF)

levels in brain tissue compared to those of infected animals treated

with vehicle (Fig.8,JtoL). The lowest dose of COR388 at 3 mg/kg

showed some reduction of brain P. gingivalis load but did not reduce

levels of brain A

1–42

or TNF (Fig.8,JtoL). Investigational new

drug application–enabling studies were completed with COR388,

and the compound is currently in clinical studies (ClinicalTrials.gov

NCT03331900).

DISCUSSION

The findings of this study offer evidence that P. gingivalis and gin-

gipains in the brain play a central role in the pathogenesis of AD,

providing a new conceptual framework for disease treatment. Ac-

cordingly, we demonstrate the presence of P. gingivalis DNA and

gingipain antigens in AD brains and show in vivo that oral admin-

istration of small-molecule gingipain inhibitors blocks gingipain-

induced neurodegeneration, significantly reduces P. gingivalis load

in the mouse brain, and significantly decreases the host A

1–42

re-

sponse to P. gingivalis brain infection.

Our identification of gingipain antigens in the brains of individ-

uals with AD and also with AD pathology but no diagnosis of de-

mentia argues that brain infection with P. gingivalis is not a result of

poor dental care following the onset of dementia or a consequence

of late-stage disease, but is an early event that can explain the pa-

thology found in middle-aged individuals before cognitive decline

(60). We also demonstrate that P. gingivalis bacterial load can be

detected in the CSF of clinical AD patients, providing further evi-

dence of P. gingivalis infection of the CNS.

The PCR analysis of P. gingivalis in the brain and CSF reported

here does not differentiate between P. gingivalis strains, and future

studies are needed to determine what P. gingivalis strains are pres-

ent in the brain and CSF and whether some strains might be more

virulent than others in causing disease. In addition, there is one other

species of Porphyromonas that is known to produce gingipains,

Porphyromonas gulae (61). P. gulae is a natural inhabitant of the oral

cavity of companion animals such as dogs, and a recent study demon-

strated that dogs can transmit P. gulae to the oral cavity of their

owners (62). Research is underway to determine whether P. gulae

may be contributing to the gingipain load in AD brains.

Evidence from our work reported here lends support to the emerg-

ing concept that A is an antimicrobial peptide (4–6), and mutations

(63,64) contributing to loss of this function could allow more ro-

bust infection with P. gingivalis and higher risk for disease. In addi-

tion, sustained high levels of antimicrobial A driven by chronic

P. gingivalis infection of the brain may be toxic to host cells, and

therefore, reduction of A levels after treatment of the P. gingivalis

infection should be beneficial. Furthermore, Down syndrome (DS),

the most common genetic cause of mental disability, has been used

to support A as a therapeutic target because of the notably high

prevalence of dementia with Alzheimer-type pathology in DS pa-

tients (greater than 50% after the age of 60) and the fact that the

amyloid precursor protein gene, which gives rise to A, is present

on chromosome 21, which is triplicated in DS (65). However, in sup-

port of our hypothesis, an aggressive form of periodontitis with rap-

id progression and onset as early as 6 years of age is associated with

DS, but not age-matched normal controls or other mentally handi-

capped patients of a similar age distribution (66). The occurrence of

P. gingivalis has been found to be significant in the subgingival plaque

of DS patients beginning around the age of 5 years when compared

to age-matched controls, indicating that P. gingivalis abnormally

colonizes DS patients in early childhood (67). The reason behind

DS patients being susceptible to P. gingivalis infection at such an

early age is unclear but may be due to the immunodeficiency that is

associated with DS (68). Research is needed to determine whether

P. gingivalis and gingipains are present in DS CSF and brain.

Although not specifically addressed in this report, once the oral

cavity is infected, P. gingivalis may access the brain and spread via a

number of pathways including (i) infection of monocytes followed

by brain recruitment (69,70), (ii) direct infection and damage to

endothelial cells protecting the blood-brain barrier (28), and/or (iii)

infection and spreading through cranial nerves [e.g., olfactory (71)

or trigeminal] to the brain. After entering the brain, we suggest that

P. gingivalis may spread slowly over many years from neuron to neu-

ron along anatomically connected pathways, similar to what has been

demonstrated for vascular cell-to-cell transmission of P. gingivalis (72).

Tau pathology has also been suggested to spread from neuron to

neuron (73), with a pattern resembling an infectious process. Our data

indicate that tau is a target of gingipain proteolysis, and we propose

that tau pathology seen in AD brains may be due to the transneuronal

spread of P. gingivalis, with direct damage of tau by gingipain pro-

teolysis as well as gingipain activation of human proteases that act

on tau. Gingipains have been shown to directly cleave procaspase-3 to

activate caspase-3 (74), a caspase that has been implicated in both

tau phosphorylation (75) and tau cleavage (76). Proteolysis of tau by

gingipains would be predicted to increase the turnover rate of tau

and trigger a compensatory increase in tau production rate to maintain

homeostasis in neurons infected by P. gingivalis. Recent research on

the kinetics of tau in the human CNS using the tau mid-domain

TPSLPTPPTR fragment as a reporter found that the production

rate of tau was increased in CSF of subjects with preclinical and

clinical AD (52). Our data demonstrating that both Kgp and RgpB

independently correlate with tau load in AD brains lend support to

the hypothesis that gingipains may be a driver of a compensatory

increase in tau production. Last, further research is needed to deter-

mine whether the gingipain-generated C-terminal tau fragments

containing the hexapeptide microtubule-binding domains that we

identified in vitro can drive tau filament formation in vivo.

Here, we have not addressed how P. gingivalis infection might

relate to apolipoprotein E4 (APOE4), the greatest genetic risk factor

for sporadic AD (77). Studies in mice deficient in APOE proteins

demonstrated an impaired innate immune response to the bacterial

pathogen Listeria monocytogenes (78), implicating APOE in normal

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

11 of 21

innate immune function in vivo. It was recently reported that human

APOE is a target of gingipain proteolysis, and the authors suggested

that this mechanism could generate neurotoxic APOE fragments in

the AD brain (79). We propose that APOE4 may be more susceptible

to gingipain cleavage than APOE3 or APOE2 due to the presence of

more arginine residues, resulting in decreased innate immune func-

tion and the generation of neurotoxic fragments (80). The distinct

role of APOE in relation to P. gingivalis infection and targeting by

gingipains remains a focus of future studies.

Our identification of P. gingivalis in the CNS underscores the

importance of genetic findings linking innate immune response

genes to AD susceptibility, including TREM2 (81), TLR4 (82), CR1

(83), and NLRP3 (84). For example, recent studies have highlighted

the association between variants of triggering receptor expressed on

myeloid cells 2 (TREM2) and AD (81). TREM2 encodes a receptor

expressed on immune cells such as macrophages and microglia, with

heterozygous TREM2 variants conferring a risk of developing AD

similar to one copy of APOE4 (81). TREM2 has been shown to reg-

ulate inflammatory responses (85) and serve as a phagocytic recep-

tor for bacteria (86). TREM1, which shares homology with TREM2,

has also been linked to AD amyloid pathology and cognitive decline

(87). The risk-associated TREM1 allele was shown to decrease TREM1

surface expression on monocytes (87). P. gingivalis has been shown

to induce TREM1 gene expression (88), and it is therefore possible

that carriers of the TREM1 AD–associated allele have a reduced

ability to respond to infection by P. gingivalis. In addition, TREM1

is a target for gingipain proteolysis and degradation, with data show-

ing that Rgp can cleave soluble TREM1 from the cell surface and

that Kgp can degrade TREM1, actions that could induce chronic

inflammation (88). Additional research is needed to determine whether

TREM2 is involved in the innate immune response to P. gingivalis

and whether P. gingivalis and gingipains have similar effects on the

expression and degradation of TREM2 as they do for TREM1. In

summary, we propose that genetic polymorphisms of innate immune

system genes in essential immune pathways may result in defective

clearance of P. gingivalis and gingipains from the brain, resulting in

chronic, low-level infection and neuroinflammation in susceptible

individuals.

With regard to infection-induced neuroinflammation, inflam-

masomes, multiprotein complexes that act as intracellular innate

immune defense systems (89), have been shown to be activated in

AD brains (90). P. gingivalis has been shown to modulate inflam-

masome activity (91). Recent research indicates that A plaque for-

mation in AD is connected to the innate immune response through

activation of the NLRP3 inflammasome in microglia and release of

ASC specks that drive A assembly and deposition (92). Notably,

P. gingivalis was the first microbial pathogen shown to induce ASC

aggregation specks in P. gingivalis–infected primary human monocytes

through activation of the NLRP3 inflammasome (93). Inflammasomes

act in intracellular innate immune defense against intracellular

pathogens by activating interleukin-1 (IL-1) and IL-18, causing

cell death through pyroptosis and thereby eliminating the intracel-

lular niche for pathogen replication (94). Furthermore, recent reports

have shown that P. gingivalis OMVs, nanoscale proteoliposomes that

are enriched in gingipains and released into surrounding tissues, are

rapidly internalized into mammalian cells (95), where they drive

NLRP3 inflammasome activation and ASC speck formation and

cause cell death through pyroptosis (96,97). This research suggests

that P. gingivalis in the human brain, through release of OMVs enriched

in gingipains, could drive NLRP3 inflammasome activation, ASC

speck aggregation, and subsequent A plaque formation. In addi-

tion, recent evidence has shown that the NLRP1 inflammasome in

neurons can detect bacterial virulence factors such as proteases by

serving as a substrate for the pathogenic enzymes (98). We suggest

that intraneuronal gingipains may therefore drive neuronal NLRP1

activation, resulting in pyroptosis of neurons and activation of

caspase-1, leading to release of the neuroinflammatory interleukins

IL-1 and IL-18.

Last, we have shown that broad-spectrum antibiotics do not pro-

tect against P. gingivalis–induced cell death in vitro, whereas gingipain

inhibitors do. We also demonstrated in vivo that an orally adminis-

tered Kgp inhibitor is more effective than a high-dose subcutaneous

broad-spectrum antibiotic in clearing P. gingivalis from the brain.

It was recently demonstrated that a small-molecule inhibitor of a

Clostridium difficile cysteine protease virulence factor, TcdB, reduced

disease pathology in a mouse model of C. difficile–induced colitis

but did not reduce the C. difficile bacterial load (99). In contrast, we

report here that small-molecule inhibition of the cysteine protease

Kgp reduced not only disease pathology in mouse brain but also

P. gingivalis bacterial load. The mechanisms underlying the decrease

in P. gingivalis bacterial load in the brain by Kgp inhibitors are likely

due to reduction of Kgp-generated peptide nutrients essential for

the growth of this asaccharolytic bacterium (100) and blocking of

Kgp-dependent heme acquisition that is critical for P. gingivalis en-

ergy production (101,102). We have demonstrated that P. gingivalis

develops rapid resistance to a broad-spectrum antibiotic, moxiflox-

acin, but not to the Kgp inhibitor COR388. Therefore, with the

growing concern about widespread antibiotic resistance (103), and

severe side effects such as C. difficile colitis from broad-spectrum

antibiotic use (104), an antivirulence factor inhibition approach to

treatment of P. gingivalis is the most promising path while reducing

pressures for resistance.

In conclusion, we have designed an orally bioavailable, brain-

penetrant Kgp inhibitor currently being tested in human clinical

studies for AD. The present data indicate that treatment with a po-

tent and selective Kgp inhibitor will reduce P. gingivalis infection in

the brain and slow or prevent further neurodegeneration and accu-

mulation of pathology in AD patients.

MATERIALS AND METHODS

Study design

This study was conducted to investigate the prevalence of P. gingivalis

in the AD brain and to elucidate possible P. gingivalis–dependent

mechanisms of action for neurodegeneration and AD pathology. In

addition, we performed a series of preclinical studies to enable the

development of a therapeutic compound against P. gingivalis–induced

AD. To demonstrate the presence of gingipain antigens in the AD

brain, TMAs containing nondemented control and AD brain tissue

were used for IHC. To avoid potential bias and subjective elements

in assessing the results, stained TMAs were scanned and images were

analyzed for gingipain IR using the MetaMorph image analysis pro-

gram. Evidence for the presence of P. gingivalis in the AD brain was

further verified by IP, WB, and PCR. To demonstrate the presence

of P. gingivalis in the CNS of living patients prospectively diagnosed

with probable AD, CSF was analyzed for P. gingivalis by PCR. The

in vitro experiments to demonstrate P. gingivalis fragmentation of tau

analyzed by WB and MS were designed after detecting the correlation

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

12 of 21

of increased tau load with gingipains in the TMAs and the colocal-

ization of gingipain with tau tangles in human AD brain. To study

the efficacy of gingipain inhibitors and neurodegenerative effects of

chronic P. gingivalis infection in vivo, we developed a mouse model

for chronic infection with P. gingivalis. The sample size for the mouse

model for brain infection with P. gingivalis was empirically deter-

mined on the basis of effect size and SD. A blinded observer per-

formed quantification of the loss of hippocampal GABAergic neurons

after P. gingivalis brain infection and the number of degenerating

neurons after intrahippocampal injection of gingipains. The efficacy

of the top lead compound, COR388, was determined in the brain by

qPCR for P. gingivalis–specific genes and by enzyme-linked immuno-

sorbent assay (ELISA) for A

1–42

and TNF. Animals were assigned

to each experimental group with an equal probability of receiving

vehicle or treatment.

Human tissue samples

The human postmortem brain tissue obtained from the Neurological

Foundation of New Zealand Human Brain Bank at the University of

Auckland was donated to the Brain Bank with family consent, and

its use for this study was approved by the University of Auckland

Human Participants Ethics Committee. The control cases had no

history of neurological abnormalities, and cause of death was unre-

lated to any neurological condition. Independent pathological anal-

ysis confirmed that any amyloid pathology was deemed normal for

age in the control cases selected for this study. Pathological analysis

was carried out on all AD cases used in this study to determine

pathological diagnosis and to assign pathological grades, which, to-

gether with a history of dementia, confirmed the diagnosis (tables S1

and S2).

Postmortem tissue samples collected under institutional review

board (IRB)–approved protocols were obtained from the University

of California Davis Alzheimer’s Disease Center, the University of

California San Francisco (UCSF) Neurosurgery Tissue Bank, Proteo-

Genex (Culver City, CA), and PrecisionMed (Solana Beach, CA).

Gingival tissue samples were collected from human volunteers with

chronic periodontal disease who provided signed informed consent

after the nature and possible consequences of the studies were ex-

plained under a University of California at San Francisco IRB–

approved protocol (approval no. 11-05608). CSF and saliva samples

were collected from human volunteers with a diagnosis of probable

AD who provided signed informed consent after the nature and

possible consequences of the studies were explained under an IRB-

approved protocol obtained from PrecisionMed (Solana Beach, CA).

Oral plaque and saliva samples were collected from human volun-

teers with chronic periodontal disease who provided signed informed

consent after the nature and possible consequences of the studies

were explained under an IRB-approved protocol obtained from the

Forsyth Institute (Cambridge, MA).

Animals

Specific pathogen–free (SPF) female BALB/c mice were purchased

from Envigo (UK) for the oral infection experiments with P. gingivalis.

Mice were maintained in individually ventilated cages and fed a

standard laboratory diet and water ad libitum under SPF conditions

within the animal care facility at Faculty of Biochemistry, Biophysics

and Biotechnology, the Jagiellonian University, Krakow, Poland. Mice

were kept under a 12-hour light/dark cycle at 22° ± 2°C and 60 ± 5

relative humidity. Control and bacterially infected mice were housed

in separate cages. To study A

1–42

levels in the brains of orally in-

fected mice and the efficacy of gingipain inhibitors to decrease

P. gingivalis infection of the brain, 40 (n = 8 per arm) 43- to 44-week-

old female BALB/c mice or 100 (n = 10 per arm) 8-week-old female

BALB/c mice were used, respectively. All the experiments were re-

viewed and approved by the I Regional Ethics Committee on Ani-

mal Experimentation, Krakow, Poland (approval nos. 164/2013 and

116/2016).

To study neurodegeneration after stereotactic injection of gin-

gipains into mouse hippocampus, fifteen 8-week-old male BALB/c mice

were purchased from Envigo (USA). Animals were group-housed

(n = 2 to 4 per cage) in plastic cages. Animals were maintained on a

12/12-hour light/dark cycle with the room temperature (RT) main-

tained at 22° ± 2°C and approximately 50% humidity and received

standard rodent chow and tap water ad libitum in the Brains On-Line,

LLC Animal Facility (South San Francisco, CA). Experiments were

conducted in accordance with the protocols approved by the Insti-

tutional Animal Care and Use Committee of Brains On-Line, LLC

(approval no. US16003).

Antibody production

Polyclonal antibodies CAB101 and CAB102 were produced by

GenScript USA Inc. (New Jersey) according to their express immu-

nization protocol. Briefly, immunogens were expressed in a bacterial

expression system and used for four consecutive immunizations of

four rabbits each. The immunogen sequences expressed are 401 to

736 residues for CAB101 (RgpB; GenBank: BAG33985.1) and 22 to

400 residues for CAB102 (Kgp; GenBank: BAG34247.1). After the

last immunization, sera were pooled and antigen affinity– purified.

Specific binding was tested on WBs, and nonspecific binding on hu-

man histology sections was controlled by coincubation of polyclonal

antibodies with their respective immunogens before IHC staining.

Human TMAs

Human brain TMAs comprised a total of 58 2-mm-diameter core

samples, 29 from dementia-free control individuals and 29 from AD

cases, each on two arrays (NVD003 and NVD005). Final sample

sizes reflect the loss of several samples from the slide during pro-

cessing (see tables S1 and S2).

IHC to detect gingipains, tau, and ubiquitin in human TMAs

TMAs were constructed from paraffin-embedded MTG blocks, as de-

scribed in detail by Narayan etal. (105). TMA sections were cut at a

thickness of 7 m and were annealed to slides by heating at 60°C for

1 hour. Sections were then dewaxed using xylene immersion in xylene

twice (1 hour and 10 min, respectively) and rehydrated using a stan-

dard graded ethanol series procedure. For IHC, slides were immersed

in sodium citrate antigen retrieval buffer (pH 6), heated at 121°C for

2 hours in 2100 Antigen Retriever (Aptum, Pick Cell Laboratories),

and then rinsed three times for 5 min in milliQH

O. For tau (1:20,000;

rabbit A0024, DAKO), IHC slides were immersed in 99% formic acid

for 5 min, rinsed three times in milliQH

O, and then treated as per

other slides. Slides were then incubated with an endogenous peroxi-

dase blocking solution (50% methanol, 1% H

, diluted in mQH

for 20 min at RT. This was followed by three washes in PBS, and then

slides were incubated with blocking buffer (10% normal goat serum

in PBS) for 1 hour at RT. Primary antibodies mouse anti-ubiquitin

(1:2000; MAB1510, Chemicon), CAB101 (1:500), and CAB102 (1:500)

were applied for incubation overnight at 4°C.

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

13 of 21

To detect antibody binding, slides were washed in PBS with Triton

X-100 for 5 min and then twice in PBS for 5 min each and incubated

with biotinylated goat anti-mouse or anti-rabbit antibodies (Sigma-

Aldrich) for 3 hours at RT. After further washing, they were incu-

bated for 1 hour at RT with Sigma Extravidin peroxidase at 1:1000

dilution and then washed and incubated with the peroxidase sub-

strate [3,3′-diaminobenzidine with 0.04% Ni(NH

)

(SO

)

] to de-

velop the color change. Following PBS-milliQH

O washes (3 × 5 min

each), the slides were dehydrated in a graded ethanol series followed by

xylene and mounted under coverslips with DPX mounting medium.

Gingipain antibodies were optimized initially on formalin-fixed

paraffin-embedded sections of gingival tissue collected from peri-

odontal disease patients at the UCSF School of Dentistry under an

IRB-approved protocol. Testing was then performed on MTG (from

both postmortem control and AD human brains) and cerebellum

(negative control). Specificity of antibody staining was demonstrated

using positive and negative controls, secondary antibody only, iso-

type controls, and antigen pre-absorption. “No primary” antibody

controls were negative for staining. Stained slides were scanned at

10× objective using a MetaSystems VSlide slide scanner, and bright-

field images were analyzed for gingipain (and other markers) IR

using the MetaMorph image analysis program. For each marker, the

images were thresholded. Two thresholds for each core were deter-

mined: one to determine the total area of the core and the other to

determine the total area of the thresholded region. To determine

the load of staining per core, the thresholded area of staining was

divided by the total core area. This analysis controlled for varying

core sizes.

IHC of human AD brain sections for neurons, astrocytes,

and RgpB-IR

For 18E6 analysis, which recognizes a unique epitope within the im-

munoglobulin (Ig)–like domain of Arg-gingipain (RgpB) (58), IHC

was performed using the Ventana Benchmark XT automated slide

preparation system at the UCSF Brain Tumor Research Center tis-

sue core. For immunoperoxidase staining, after tissue sections (5 m

thickness) were deparaffinized (at 75°C; EZ-Prep, Ventana Medical

Systems), antigen retrieval was performed for 30 min [Cell Condi-

tioning 1 (pH 8.5), Ventana Medical Systems] at 95° to 100°C. H

(3%) (Thermo Fisher Scientific) was applied for 8 min to reduce

background staining. Antibody 18E6 (University of Georgia Mono-

clonal Antibody Facility) was incubated at RT for 32 min at 1:10

dilution. Staining was developed using the UltraView Universal

DAB Detection System (Ventana Medical Systems), and slides were

counterstained with hematoxylin.

For immunofluorescence, sections were deparaffinized in xylene

and rehydrated in a graded alcohol series. Heat-mediated antigen

retrieval was performed with citric buffer (pH 6.0) (H-3300, Vector

Laboratories). After PBS washes, sections were incubated in block-

ing solution, 5% donkey serum, and 0.3% Triton X-100 in PBS for

1 hour at RT. Sections were then incubated overnight at 4°C in

primary antibodies anti-MAP2 (1:500; ab5392, Abcam), CAB101

(1:500), anti-IBA1 (1:1000; ab97120, Abcam), anti–-amyloid, 17–24

(1:500; SIG-39200; 4G8, BioLegend), and anti-AT8 (1:2000; MN1020B,

Thermo Fisher Scientific) in 3% donkey serum and 0.3% Triton

X-100 in PBS. After PBS washes, slides were incubated with second-

ary antibody solution, either Alexa Fluor 647 goat anti-chicken

(1:200; A21449, Life Technologies) and Alexa Fluor 488 donkey anti-

rabbit (1:200; Jackson ImmunoResearch) mixed with anti–GFAP-

Cy3 (1:250; MAB3402C3, Millipore) or Cy3-donkey anti-rabbit

(1:200; Jackson ImmunoResearch), Alexa Fluor 488 donkey anti-

mouse (1:200; Jackson ImmunoResearch), and Alexa Fluor 647

donkey anti-goat (1:200; Jackson ImmunoResearch) in PBS with

0.3% Triton X-100 for 2 hours at RT. Sections were washed in PBS

and counterstained with 4′,6-diamidino-2-phenylindole (DAPI)

(Invitrogen; D1306). Autofluorescence was quenched with TrueBlack

Lipofuscin Autofluorescence Quencher 1:20 in 70% ethanol (catalog

no. 23007, Biotium), and slides were mounted with ProLong Gold

Antifade (P36930, Thermo Fisher Scientific). Coimmunofluorescence

on P. gingivalis was performed by drying bacteria on SuperFrost

Plus microscope slides. Bacteria were immersed in 4% paraformal-

dehyde for 10 min, washed three times in PBS, and incubated in

formic acid for 7 min, followed by another three washes with PBS.

Cells were exposed to anti–-amyloid, 17–24 (1:500; SIG-39200; 4G8,

BioLegend) and CAB101 (1:500) in 3% donkey serum and 0.3% Triton

X-100 in PBS for 30 min at RT, followed by 30-min incubation in

Cy3-donkey anti-rabbit (1:200; Jackson ImmunoResearch) and Alexa

Fluor 488 donkey anti-mouse (1:200; Jackson ImmunoResearch) in

PBS, counterstained with DAPI, and coverslipped with ProLong Gold

Antifade (Thermo Fisher Scientific; P36930).

Histological analysis was performed on an Olympus BX61 motor-

ized microscope. Fluorescence images were taken with a sCMOS

camera (Zyla-5.5-USB3, Andor), and brightfield images were taken

on a color charge-coupled device camera (DP27, Olympus). Images were

processed for brightness and contrast correction, cropping, and ad-

dition of scale bars with CellSens 1.14 Dimension software (Olympus).

Human brain Kgp IP and WB

Brain tissue from each subject sample (cortex, 100 mg) was homog-

enized on ice in 1 ml of B-PER lysis buffer (Thermo Fisher Scientif-

ic) with proteinase inhibitor cocktail (Millipore) and then kept on

ice for 10 min. The bacteria control was prepared by pelleting 10

bacteria by centrifugation at 5000g for 10 min. Then, the pellet was

lysed in 1 ml of the same lysis buffer on ice for 10 min. All samples

were then centrifuged at 16,000g for 20 min at 4°C, and the super-

natant was collected. Protein concentration was measured using a

Pierce BCA assay kit (Thermo Fisher Scientific). One milligram of

total protein from each sample was denatured at 95°C for 5 min,

and then an equal volume of antibody binding and washing buffer

from the Dynabeads Protein G Immunoprecipitation Kit (Thermo

Fisher Scientific) was added. For the bacteria control, 10

bacteria

were used. For the brain sample spiked with bacteria, 1 mg of total

brain protein was mixed with bacterial lysate of 10

bacteria. The

samples were incubated with 10 g of rabbit polyclonal CAB102 anti-

body with rotation overnight at 4°C. The next day, prewashed

Dynabeads Protein G beads were incubated with 1 mg of bovine

serum albumin (BSA) in binding buffer for 30 min and then washed

three times with washing buffer. Then, samples were incubated with

Dynabeads with rotation for 30 min at RT. Samples were washed

four times with 200 l of washing buffer using magnetic rack. Beads

were then dissolved with 20 l of elution buffer and 10 l of NuPAGE

LDS sample buffer and 50 mM dithiothreitol (DTT) and heated at

70°C for 10 min. Then, IP proteins were eluted from the magnetic

beads using magnetic rack. Each sample (15 l) was then subjected

to SDS–polyacrylamide gel electrophoresis (PAGE) electrophoresis.

SDS-PAGE gel was subjected to WB analysis by using Trans-blot

Turbo transfer system (Bio-Rad) to transfer proteins to polyvinylidene

difluoride (PVDF) membrane. The membrane was then rinsed with

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

14 of 21

tris-buffered saline (TBS) and then blocked with blocking buffer from

the Clean-Blot IP Detection Kit (Thermo Fisher Scientific) for 1 hour.

The blot was then incubated with 1:1000 primary antibody CAB102

overnight with rocking in blocking buffer at 4°C. The blot was then

washed three times with TBST buffer, 5 min each, and then incubated

with 1:250 dilution of Clean-Blot detection reagent [horseradish per-

oxidase (HRP)] in blocking buffer for 1 hour at RT. Blot was then

washed four times with TBST and then subjected to Pierce ECL de-

tection reagent and ChemiDoc imaging system.

qPCR analysis of P. gingivalis in human brain tissue

DNA was extracted and purified from postmortem cortex brain tis-

sues following the protocol described in the Blood and Tissue Kit

(Qiagen). Copy number of the P. gingivalis genome in brain DNA

samples was determined by qPCR with P. gingivalis–specific 16S

primers [(ACCCTTTAAACCCAATAAATC (forward) and ACGAG-

TATTGCATTGAATG (reverse)] and fluorescent-labeled probe

(CGCTCGCATCCTCCGTATTAC). The qPCR reaction mixture

contained 100 ng of brain DNA, 0.5 M primers/0.15 M probe, and

Kapa Fast qPCR Mix (Kapa Biosystems). PCR amplification was

performed using the following cycling parameters: 3 min at 95°C,

50 cycles of 3 s at 95°C, and 30 s at 60°C. Copy number was deter-

mined from the standard curve generated using a synthetic template.

Sequence analysis of P. gingivalis DNA amplified from

human brain tissue

For sequencing, an approximately 1-kb region of the P. gingivalis

genome encompassing the hmuY gene (except sequences correspond-

ing to the first six amino acids) was amplified from 50 ng of brain

DNA by PCR. PCR amplification (95°C/5 min; 95°C/20 s, 60°C/15 s,

and 72°C/1 min for 35 cycles; 72°C/2 min) was performed using the

KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) and

primers [TTCTCCGCACTCTGTGCATT (forward) and AGCACTTC-

GATTCGCTCGAT(reverse)] designed to amplify the hmuY gene

from the P. gingivalis genome. PCR products were run on 2% agarose

gel, and DNA bands close to the expected size (based on the PCR

product obtained from amplification of purified P. gingivalis DNA)

were excised from the gel (Fig.2F). DNA was extracted from the gel

pieces following the protocol described in the Gel Extraction Kit

(Qiagen). Approximately 5% of the eluted DNA was reamplified

using the same hmuY PCR primers. Sequencing of reamplified PCR

products was performed using nested primers (fig. S3).

qPCR analysis of P. gingivalis in human CSF and saliva

CSF and matching saliva samples were obtained from PrecisionMed

(Solana Beach, CA). Ten volunteer subjects, who were diagnosed with

probable AD and met the criteria of having a Mini Mental Status Exam

(MMSE) score of 20 or below, were serially enrolled in PrecisionMed’s

IRB-approved protocol for CSF collection in November 2017 and

donated CSF samples and matching saliva samples for P. gingivalis

PCR analysis.

CSF PCR method

DNA was extracted from 50 l of CSF using Puregene Core Kit A

(Qiagen). The final DNA pellet was dissolved in 50 l of DNA hy-

dration buffer. A preamplification PCR assay (20 cycles) was per-

formed with 5 l of CSF DNA and P. gingivalis hmuY gene–specific

H1.2 primers [GGTGAAGTCGTAAATGTTAC (H1.2 forward) and

TTGACTGTAATACGGCCGAG (H1.2 reverse)]. A serial dilution

of synthetic template DNA was also preamplified for the calculation

of copy number. The preamplified PCR products were diluted, and

a qPCR assay was performed with nested hmuY primers [GAAC-

GATTTGAACTGGGACA (H1.1 forward) and AACGGTAGTAG-

CCTGATCCA (H1.1 reverse)] and a probe (/56-FAM/TTCTGTCTT/

ZEN/GCCGGAGAATACGGC/3IABkFQ/). A serial dilution of the

same synthetic template DNA was included in the qPCR assay to

generate a standard curve and calculate starting copy number in CSF.

Saliva PCR method

DNA was extracted from 50 l of saliva using Puregene Core Kit A

(Qiagen). The final DNA pellet was dissolved in 50 l of DNA hy-

dration buffer. A qPCR assay was performed with 2 l of saliva DNA

and hmuY primers (H1.1) and the probe mentioned above. A serial

dilution of synthetic template DNA was included in the qPCR assay

to calculate starting copy number.

qPCR analysis of H. pylori in human brain and CSF

The preamplification and qPCR protocol used for detection of

H. pylori copy number in brain, CSF, and saliva samples were the same

as those used for detecting the P. gingivalis hmuY gene copy number

noted above. The qPCR primers and probe used for detection of H. pylori

copy number have previously been described (43). We designed two

primers [GATTAGTGCCCATATTATGGA (Hpy_outer_For) and

CTCACCAGGAACTAATTTAC (Hpy_outer_Rev)] for the pream-

plification step. These primers amplified a 217-bp fragment encom-

passing the region amplified by the qPCR primers. A synthetic DNA

of 240 bases encompassing the region amplified by outer primers

was used as a control for the preamplification step.

Effects of P. gingivalis infection on tau in SH-SY5Y cells

SH-SY5Y cells (~2.4 × 10

) were spin-inoculated with MOIs of 10,

50, and 100 with each of the following: P. gingivalis [American Type

Culture Collection (ATCC) BAA-308] [wild type (WT)], P. gingivalis

KgPIg-B, and P. gingivalis K/RAB-A. Uninfected SH-SY5Y cells

were used as a control. SH-SY5Y cells and P. gingivalis strains were

centrifuged at 1000g for 10 min at RT in Dulbecco’s modified Eagle’s

medium (DMEM)/F12 supplemented with 2 mM

l-glutamine and

BSA (200 g/ml), followed by incubation for 1, 4, and 8 hours, re-

spectively, in a CO

incubator. After the indicated incubation times,

cells were collected and cell pellets were lysed with 250 l of radio-

immunoprecipitation assay buffer supplemented with protease in-

hibitor cocktail for 10 to 15 min. Total protein (16 g) was used for WB.

WBs were probed with tau monoclonal antibody TAU-5 (Thermo-

MA5-12808). Glyceraldehyde-phosphate dehydrogenase (GAPDH)

was used as an internal reference.

Tau-441 incubation with gingipains and WB

Tau-441 (2N4R) (rPeptide, T-1001-1; molecular weight, 45.9 kDa)

(2 g) was reconstituted in 1% NH

OH and digested by 100, 10, 1,

and 0.1 nM Kgp/RgpB in working buffer [20 nM sodium phosphate

and 1 mM DTT (pH 7.5)]. Digestion reactions were performed for

1 hour at 37°C; reactions were stopped with protease inhibitor

(P8340, Sigma-Aldrich). Proteins were separated by electrophoresis

at 70 V for 15 min and then at 85 V for 1.5 hours on a 10% Criterion

TGX precast gel (Bio-Rad, 5671033) (Bio-Rad, Criterion vertical

electrophoresis cell) and electroblotted overnight onto a PVDF

membrane at 10 V (Bio-Rad, Criterion Blotter). Blot was blocked

with BLOTTO (87530, Thermo Fisher Scientific) for 1 hour and

probed with primary antibody anti-Tau46 (13-6400, Thermo Fisher

Scientific) at 1:1000 dilution in 3% BSA in TBS for 2 hours. Blot was

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

15 of 21

then washed three times for 10 min each with TBST (28630, Thermo

Fisher Scientific) and then incubated with secondary antibody HRP

goat anti-mouse (1:50,000; 31439, Thermo Fisher Scientific) in 3%

BSA in TBS for 30 min. After further washing, blot was washed

three times for 10 min with TBST, and blot staining was visualized

using chemiluminescence detection (34096; SuperSignal West Femto,

Thermo Fisher Scientific).

Liquid chromatography–MS/MS analysis of

gingipain-generated tau cleavage products

Tau samples treated with 1 nM Kgp/RgpB or 10 nM Kgp/RgpB were

analyzed by 1D Nano LC-MS/MS (JadeBio, San Diego, CA). A reversed-

phase column (200 m × 20 cm C

2.5 m 130 Å) was generated in-

house and coupled online to a Q Exactive mass spectrometer (Thermo

Fisher Scientific, Bremen, Germany). Peptides were separated by a

linear gradient from 95% buffer A [0.1% formic acid (FA) in water]/5%

buffer B [0.1% FA in acetonitrile (ACN)] to 60% buffer A/40% buf-

fer B over 150 min at 500 nl/min. The mass spectrometer was oper-

ated in a data-dependent TOP20 mode with the following settings:

mass range, 400 to 2000 mass/charge ratio (m/z); resolution for MS

scan, 70,000 full width at half maximum (FWHM); resolution for MS

scan, 17,500 FWHM; isolation width, 3 m/z; NCE, 27; underfill ratio,

1%; dynamic exclusion, 15 s. Raw MS/MS spectra were searched

against UniProt Human + P. gingivalis + decoy sequence databases.

False discovery rate was <0.1% at the peptide level.

Small-molecule gingipain inhibitor characterization

Structure-based design was used to develop a library of gingipain

inhibitors, which were tested on purified Kgp and RgpB to assess

potency and determine inhibition constants. The detailed chemical

synthesis and structure of compounds in the relevant series of argi-

nine gingipain inhibitors including COR286 can be found in In-

ternational Patent Application PCT/US2015/054050 and PCT/

US2016/061197. The detailed chemical synthesis and structure of

compounds in the structural series for lysine gingipain inhibitors

including COR119, COR271, and COR388 can be found in PCT/

US2016/061197. The capacity of compounds to inhibit the activity

of lysine or arginine gingipain was measured in a fluorogenic assay.

The assay was performed in buffer [100 mM tris-HCl, 75 mM NaCl,

2.5 mM CaCl

, 10 mM cysteine, and 1% dimethyl sulfoxide (DMSO)

(pH 7.5)] for 90 min at 37°C. Kgp, RgpB, and RgpA were isolated

from culture of P. gingivalis, as described by Potempa and Nguyen (39).

The fluorogenic substrate for Kgp was 10 M Z-His-Glu-Lys-MCA

and for RgpA and RgpB was 10 M Boc-Phe-Ser-Arg-MCA. Trypsin

buffer was 10 mM tris and 10 mM CaCl

(pH 8.0), and the substrate

was Z-Gly-Gly-Arg-AMC. COR286 has an IC

of ≤20 pM on pu-

rified RgpB and an IC

of 300 pM on structurally related RgpA but

no significant inhibition of Kgp. COR119 has an IC

of 10 nM on

Kgp, with COR271 and COR388 having IC

values of ≤50 pM on

Kgp. All have no significant activity on RgpB. All compounds show

negligible inhibition of trypsin with IC

values of ≥10 M. COR271

and COR388 were profiled more extensively on a series of cellular

proteases, and no biologically meaningful activity (IC

> 10 M) was

detected on these enzymes including cathepsin S, calpain, tryptase,

thrombin, plasmin, FXa, FVIIa, BACE1, DPP4, proteasome, deu-

biquitinating peptidases, and caspase family enzymes.

A Morrison inhibition constant (K

) was determined for COR271

and COR388, and both display a K

of <0.01 nM. Enzyme kinetic

studies were performed to determine the mode of inhibition of the

compounds by monitoring recovery of enzyme activity following

dilution of existing enzyme/inhibitor complexes. COR119 is a re-

versible inhibitor, and COR271 and COR388 display irreversible

binding kinetics. COR286 contains an identical catalytic binding

site mechanism as COR271. The enzyme progress curves from this

study were used to estimate K

off

and T

1/2

(half-life) of the reversible

enzyme complex with COR119. Fitting the progress curve allows an

estimate of K

off/obs

(min

−1

) of 0.032 and T

1/2

of 22 min for COR119.

A K

off

value for COR271 and COR388 cannot be calculated, as their

binding is irreversible.

The COR553 activity probe was prepared by the copper-catalyzed

azide-alkyne cycloaddition reaction (106) between an azide deriva-

tive of the irreversible Kgp inhibitor COR553 and an alkyne amide

derivative of the Cy5 fluorophore. The COR553 probe forms an ir-

reversible covalent bond with a catalytic cysteine residue in the ac-

tive site of Kgp by displacement of a phenol leaving group.

Effect of gingipain inhibitors on P. gingivalis toxicity

in SH-SY5Y cells

Human neuroblastoma SH-SY5Y cells at 13 passages were cultured

in complete medium [DMEM/F12 (Invitrogen) supplemented with

2 mM

l-glutamine (Invitrogen), 10% heat-inactivated fetal bovine

serum (10099141, Invitrogen), and 1% penicillin-streptomycin

(Invitrogen)] in a 5% CO

incubator (Thermo Fisher Scientific). Cells

were seeded at a density of 2 × 10

to 4 × 10

cells per well (200 l of

1 × 10

to 2 × 10

cells/ml) in 96-well black/flat-bottom plates

(Greiner) manually coated with collagen type I and then incubated

in a CO

incubator at 37°C.

When cells reached 70 to 80% confluency (~6 × 10

cells per

well), they were challenged with P. gingivalis with or without COR271,

COR286, moxifloxacin (32477, Fluka), doxycycline (D9891-5G, Sigma-

Aldrich), or semagacestat (S1594, SELLECK) at various concentrations.

On the day of testing, the stock solution was diluted by eight

serials of twofold dilution in DMSO (Sigma-Aldrich) in a sterile

V-bottom 96-well plate (WIPP0280, Axygen) from well 2 to well 10.

Well 11 contained DMSO only. From well 2 to well 11, the concen-

trations were 12.8, 6.4, 3.2, 1.6, 0.8, 0.4, 0.2, 0.1, 0.05, and 0 mg/ml.

This was the compound mother plate, with each well containing

200× testing concentrations of compound in DMSO. Then, 6  l

from the mother plate was transferred into a 96-deep-well plate

filled with 594  l of complete medium–penicillin/streptomycin

(1:100 dilution) to 2× testing concentration (128, 64, 32, 16, 8, 4, 2,

1, 0.5, and 0 g/ml). This was the working solution.

P. gingivalis (ATCC BAA-308) was inoculated from −80°C stock

onto a brain heart infusion agar (BD-211065). The plate was incu-

bated for 72 hours at 37°C in an anaerobic workstation (YQX-II,

Shanghai Yuejin). The atmosphere was kept at 80% N

, 10% CO

and 10% H

On the day of testing, plates were processed in ambient atmo-

sphere. Bacteria were harvested and suspended in complete medium–

penicillin/streptomycin (without penicillin/streptomycin). Suspension

was adjusted using a Siemens MicroScan turbidity meter (Siemens)

to 0.5 turbidity, which is equivalent to ~6 × 10

CFU/ml. Bacterial

suspension was diluted in complete medium–penicillin/streptomycin

to a final bacterial density of 6 × 10

CFU/ml (for MOI of 1:1000)

including one well with no bacteria as a negative control.

Cells in the testing plate were washed once with 200 l of com-

plete medium–penicillin/streptomycin. Then, 100 l of working solu-

tion and 100 l of bacterial suspension were added. The final testing

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

16 of 21

concentrations were 64, 32, 16, 8, 4, 2, 1, 0.5, 0.025, and 0 g/ml with

1% DMSO. The testing plates were incubated at 37°C in a 5% CO

incubator for 24 hours.

Cell viability was determined using AlamarBlue (Invitrogen).

Cells in the testing plates were washed twice using complete medium–

penicillin/streptomycin to remove bacteria in the suspension. Then,

220 l of AlamarBlue/medium mix (consisting of 200 l of complete

medium–penicillin/streptomycin and 20 l of AlamarBlue) was added

to each well of the testing plates. The testing plates were then incu-

bated in a 37°C CO

incubator for fluorescent reduced AlamarBlue to

develop. The fluorescent signal from the reduced AlamarBlue (exci-

tation, 530 nm/emission, 590 nm) was read after 6 hours, before

saturation, on a SpectraMax M2e plate reader (Molecular Devices).

Stereotactic injection of gingipains in mouse hippocampus

A 7-day study was designed to detect gingipain-induced hippocam-

pal neurodegeneration with Fluoro-Jade C (FJC), a fluorescent stain

that has been shown to exhibit maximum staining of degenerating

neurons 1 week after a neurotoxic insult (107). Fifteen 8-week-old

male BALB/c mice (Envigo) were used in the study. Animals were

group-housed (n = 2 to 4 per cage) in plastic cages. Animals were

maintained on a 12/12-hour light/dark cycle, with the RT main-

tained at 22° + 2°C and approximately 50% humidity, and received

standard rodent chow and tap water ad libitum.

Mice were anesthetized using isoflurane (2%, 800 ml/min O

Bupivacaine/epinephrine was used for local analgesia, and carpro-

fen was used for perioperative/postoperative analgesia. A solution

of RgpB (5 g/ml) + Kgp (5 g/ml) + 5 mM

l-cysteine was prepared in

sterile saline. Bilateral injections of 0.5 l were made into coordinates

from bregma: anteroposterior −2.0, lateral ±1.5, and ventral −1.4 mm

from dura at a rate of 0.1 l/min with a 5-min rest period using a

Hamilton syringe (10-l syringe with corresponding 30-gauge blunt

tip needle; model no. 80308) and the stereotactic micromanipulator

(Ultra Micro Pump III with Micro4 Controller, World Precision

Instruments). When compound delivery was complete, the needle

was left in place for 5 min and then withdrawn such that it took

approximately 1 min to fully withdraw the needle.

Mice received a single administration of vehicle or drug 1.5 hours

before stereotactic gingipain injection. Inhibitor-treated mice received

COR271 (100 mg/kg) in PBS by oral gavage and COR286 (20 mg/kg)

in 25% pluronic F127 subcutaneously at a dose volume of 5 and

10 ml/kg, respectively. Vehicle-treated mice received either PBS or

pluronic.

Seven days later, mice were anesthetized with isoflurane (2%,

800 ml/min O

) and perfused with PBS. Brains were harvested,

fixed in 10% formalin, embedded in paraffin, and sectioned at 5 m.

Serial sections 200 m apart through the entire hippocampus

were stained with the FJC Ready-to-Dilute Staining Kit (Biosensis)

according to the manufacturer’s protocol, and FJC-positive cells

in the CA1 area were counted on an Olympus BX61 motorized

microscope.

Growth of P. gingivalis W83

P. gingivalis [W83 (ATCC, Rockville, MD), Kgp (kgp), and Rgp

(rgpArgpB495-B Cm

, Em

] (57,58) was streaked on tryptic soy

broth (TSB) agar plates [5% sheep blood, supplemented with

l-cysteine

(0.5 mg/ml), hemin (5 g/ml), and vitamin K (0.5 g/ml)] and grown

under anaerobic conditions at 37°C for 5 to 7 days. Samples were then

inoculated in TSB with hemin, vitamin K, and

l-cysteine (TSB-HKC)

until mid-log phase OD

600

(optical density at 600 nm) of 0.5 to 0.7.

Bacteria were washed in PBS and prepared at a final concentration

of 1 × 10

cells/ml in PBS + 2% methylcellulose.

P. gingivalis oral infection in mice

Experimental periodontitis was induced by ligature placement.

During the procedure, mice were anesthetized with an intraperito-

neal injection of ketamine (200 mg/kg; VetaKetam, Poland) and

xylazine (10 mg/kg; Sedasin, Biowet, Poland), and the eyes were lu-

bricated with ointment (Puralube Vet; PharmaDerm, Melville, NY).

Next, a 5-0 silk ligature (Roboz Surgical Instrument Co., MD, USA)

was tied around the upper maxillary left and right second molar.

Suture was applied and tied gently to prevent damage to the peri-

odontal tissue. The ligature was left in position for the entire exper-

imental period so that inflammation could be constantly induced by

colonization of bacteria inside of it.

Experiment 1

To study A

1–42

levels in the brains of orally infected mice, 40 (n = 8

per arm) 43- to 44- week-old female BALB/c mice were infected for

6 weeks every other day. For infection, 100 l of the bacterial solu-

tion was applied topically to the buccal surface of the maxillae.

COR119 in 2% DMSO/PBS was administered three times a day by

subcutaneous injection starting on day 21 and continuing through

day 42. Vehicle-treated animals received DMSO only. To further

define the role of gingipains in the induction of brain A

1–42

, mice

were infected with P. gingivalis W83 (WT) or P. gingivalis lacking

Kgp (kgp) or the Rgp-null P. gingivalis mutant strain (Rgp) (58).

After 6 weeks, the mice were euthanized and perfused with PBS,

and brains were harvested and frozen in liquid nitrogen.

Experiment 2

To study the efficacy of gingipain inhibitors to decrease P. gingivalis

infection of the brain, 100 (n = 10 per arm) 8-week-old female BALB/c

mice were infected for 6 weeks every other day as described above.

The mice received gingipain inhibitors or moxifloxacin for 5 weeks

(days 36 to 70). COR271 was administered orally twice daily in PBS

at 10 mg/kg; COR286 was administered subcutaneously twice daily

in 25% pluronic F127 (10 mg/kg; Sigma-Aldrich, USA). Moxifloxacin

(Sigma-Aldrich, USA) was administered subcutaneously twice daily

in PBS at 10 mg/kg. Vehicle-treated animals received PBS or pluronic

only. A group of mock-infected and P. gingivalis W83 (WT)–infected

mice were euthanized on day 35 to gather baseline measurements

before the start of treatment. After 10 weeks, P. gingivalis W83 (WT)–

infected mice and mice infected with bacteria ± gingipain inhibitors

or moxifloxacin were euthanized, and the brain and serum were

harvested and frozen in liquid nitrogen

Experiment 3

To study the efficacy of gingipain inhibitors to decrease P. gingivalis

infection of the brain, 70 (n = 10 per arm) 8-week-old female BALB/c

mice were infected for 6 weeks every other day as described above.

The mice received COR388 (3, 10, or 30 mg/kg) or COR271 (10 mg/kg)

twice daily in PBS for 5 weeks (days 36 to 70) by oral administra-

tion. Vehicle-treated animals received PBS only. Mice were eutha-

nized on day 35 or day 70, and one brain hemisphere and serum were

frozen in liquid nitrogen, while one brain hemisphere was fixed in

10% formalin.

A ELISA

Brain samples (posterior half of the left hemisphere) were homoge-

nized in radioimmunoprecipitation assay buffer (VWR), and A

1–42

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

17 of 21

was quantified with a Novex Mouse Beta Amyloid 1-42 (A42) ELISA

kit (Thermo Fisher Scientific, USA) according to the manufacturer’s

specifications.

ELISA assays for TNF

Brain lysate was quantified for TNF with ProcartaPlex Chemokine

Convenience Panel 1 (Thermo Fisher Scientific) on a Luminex plat-

form following the manufacturer’s protocol and with a V-PLEX Proin-

flammatory Panel 1 Mouse kit (Meso Scale Diagnostics, Rockville,

MD). Results from both assays were corrected for protein content

and normalized to the mock group, and the means of both assays

were analyzed as a combined dataset.

Endpoint PCR analysis of P. gingivalis in mice brain tissue

Bacterial DNA was extracted from mouse brains using DNeasy

Blood & Tissue Kits (Qiagen, Germany) according to the manufac-

turer’s protocols. The concentration of DNA was measured using a

NanoDrop 2000 (Thermo Fisher Scientific, USA). Bacterial DNA

was amplified with 16S ribosomal RNA (rRNA) primers for the

W83 strain of P. gingivalis [AGGCAGCTTGCCATACTGCG (for-

ward) and ACTGTTAGCAACTACCGATGT (reverse)]. PCR am-

plification was conducted in a 12-l reaction volume including 3 l

of brain DNA (80 ng of DNA), 6 l of EconoTaq PLUS Green 2×

Master Mix (Lucigen, USA), 0.6 l (10 M) of each primer (GenoMed,

Poland), and 1.8 l of H

O (Thermo Fisher Scientific, USA). Forty

cycles of amplification were performed in a DNA thermal cycler

(TProfessional TRIO, Biometra, Germany) consisting of 3 min for

95°C, 20 s for 95°C, 30 s for 57°C, 30 s for 72 °C, and 5 min for

72°C. The amplified product was identified by electrophoresis in a

1.5% agarose gel (BioShop, Canada). The DNA was stained with

ethidium bromide, visualized under short wavelength transillumina-

tor, and photographed in runVIEW imager (BIOCOMdirect, UK).

A

1–42

binds to the surface of P. gingivalis

Recombinant A (1-42) Ultra-Pure, Ammonium Hydroxide (rProtein)

was prepared as stock solutions (1 mg/ml) in 1% NaNH

. P. gingivalis

was washed in PBS and incubated at 10

CFU/ml in A (10, 30,

and 100 g/ml) for 1 hour at RT and ambient oxygen. For IHC, a

10-l solution was dried on a SuperFrost Plus glass slide (VWR)

fixed in 4% paraformaldehyde for 10 min. Slide was then rinsed

with PBS and dH

O, exposed to formic acid, and, after washing with

PBS, incubated for 2 hours in PBS, 0.3% Triton X-100, and primary anti-

bodies CAB102 (1:1000) and 4G8 (1:1000; BioLegend). Fluorescence

labeling was performed with Alexa Fluor 488 donkey anti-rabbit

(1:200; Jackson ImmunoResearch) and Cy3 donkey anti-goat

(1:200; Jackson ImmunoResearch) in PBS. Slides were mounted

with ProLong Gold Antifade (Thermo Fisher Scientific). Images were

taken on an Olympus BX61 microscope with a Zyla 5.5 sCMOS

camera (Andor).

Antimicrobial effects of A on P. gingivalis

Recombinant A (1-40, 1-42, 1-42 scrambled) Ultra-Pure, Ammo-

nium Hydroxide (rProtein) was prepared as 0.2 mM stock solutions

in 1% NaNH

. A peptides were added to P. gingivalis cultures at a

final concentration of 20 mM and kept at 37°C under anaerobic con-

ditions for 24 hours. Cells were washed in PBS and stained with the

LIVE/DEAD BacLight Bacterial Viability Kit (Thermo Fisher Scientific)

according to the manufacturer’s protocol. Fluorescence intensity was

quantified on a PerkinElmer Envision Plate reader.

qPCR analysis of P. gingivalis in mouse brain tissue

DNA was extracted from brain tissue using the DNeasy Blood &

Tissue Kit (Qiagen, Germany) according to the manufacturer’s pro-

tocol. TaqMan qPCR was performed with Kapa Probe fast qPCR

Mix (Rox Low) on a Bio-Rad CFX96 Real-Time System C1000

Touch ThermalCycler with the forward (5′-AGCAACCAGCTAC-

CGTTTAT-3′) and reverse (5′-GTACCTGTCGGTTTACCATCTT-3′)

primers and 6-FAM-TACCATGTTTCGCAGAAGCCCTGA-TAMRA

as the detection probe. The primers were based on single copy of

P. gingivalis arginine–specific cysteine-proteinase gene (108). Dupli-

cate samples were assayed in a total volume of 10 l, containing 100 ng

of template brain genomic DNA solution, TaqMan Universal PCR

Master Mix (2×) (Kapa Biosystems, USA), and the specific set of

primers (final concentration, 5 M) and probe (final concentration,

4 M) (GenoMed, Poland), corresponding to 562.5 nM of forward

and reverse primers and 100 nM of the probe. After an initial incu-

bation step of 2 min at 50°C and denaturation for 95°C for 20 s, 40

PCR cycles (95°C for 20 s and 60°C for 30 s) were performed. The

number of copies of the P. gingivalis genome was calculated by

matching C

values with a standard curve prepared from serial dilu-

tions of cultured P. gingivalis W83 (WT).

Quantification of hippocampal Gad67

interneurons

Anti-GAD67 antibody, clone 1G10.2 (MAB5406, MilliporeSigma),

was used at a dilution of 1:2000 for IHC. Quantification of Gad67

interneurons was performed with CellSens 1.5 Software. The area of

the hilus was defined as the area between the blades of the dentate

gyrus connected by a straight line on the open side. The number of

cells on every 40th section through the hippocampus was counted. The

results are presented as the number of cells per volume of tissue.

Preparation of P. gingivalis lysates for gel electrophoresis

Bacteria (10

) were collected and centrifuged at 5000g for 10 min at

4°C. The supernatant was discarded. Bacterial cell pellet was lysed

with 1 ml of B-PER lysis buffer (Thermo Fisher Scientific) on ice for

10 min and then centrifuged for 10 min at 14,000g at 4°C. The su-

pernatant containing protein lysate was collected.

COR553 activity probe labeling of Kgp

P. gingivalis lysate, purified Kgp, or human subgingival plaque sam-

ples were incubated with 1 M of Cy5 probe COR553 for 1 hour at

37°C with shaking. For COR388-treated samples, 1 M COR388

was added for 30 min at 37°C before the addition of COR553. Then,

samples were denatured with NuPAGE LDS sample buffer (Thermo

Fisher Scientific) containing 50 mM DTT at 95°C for 10 min and

subjected to SDS-PAGE with Criterion 4 to 15% precast gel (Bio-Rad)

and tris/glycine/SDS running buffer (Bio-Rad). Gel was run at 75 V

for 10 min and then at 125 V for 1.5 hours, followed by Cy5 visual-

ization with ChemiDoc imaging system (Bio-Rad).

IP of Kgp labeled with COR553

For IP of Cy5-labeled Kgp, the samples were incubated with 10 g of

rabbit polyclonal CAB102 antibody with rotation overnight at 4°C, in-

cubated with prewashed Dynabeads Protein G beads with rotation for

20 min at RT, washed, and magnetically separated. Beads were then

dissolved with 20 l of elution buffer and 10 l of NuPAGE LDS sample

buffer and 50 mM DTT and heated at 70°C for 10 min, eluting the IP

proteins. Samples were then subjected to SDS-PAGE, and Cy5 probe

signals were visualized with a ChemiDoc imaging system (Bio-Rad).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

18 of 21

WB analysis of COR553-labeled samples

After imaging with Cy5 detection, the same gels were transferred to

PVDF membranes and immunoblotted with anti-Kgp antibody

CAB102. Membranes were blocked with 3% BSA TBST buffer for at

least 1 hour, incubated with 1:1000 CAB102 for 2 hours at RT or

overnight at 4°C in blocking buffer, and visualized with goat anti-

rabbit IgG HRP-conjugated antibody (#31462, Thermo Fisher Sci-

entific) and chemiluminescent detection using SuperSignal West

Femto (Thermo Fisher Scientific) and a ChemiDoc imaging system.

Collection and processing of human saliva and subgingival

plaque samples

Oral subgingival plaque and saliva samples were obtained from five

human subjects with periodontal disease under an IRB-approved

clinical protocol. An unstimulated saliva sample (about 1 ml) was

obtained by collection into a sterile 15-ml falcon tube following a

2-min water rinse. Samples were collected at a consistent time of

day to avoid diurnal effects and were kept cold during and following

collection. After collection was complete, the cap of the tube was

tightly screwed and transferred to −80°C.

Two subgingival plaque samples per site were collected from

periodontal sites of four periodontal teeth with ≥6 mm pocket

depth using Endodontic absorbent paper points (size, 40). The sam-

pling sites were gently air-dried and isolated with cotton pellets to

avoid saliva contamination. The paper points were inserted in the

pockets for 30 s until resistance was felt. Paper points were held with

pliers, removed from the site, and placed into prelabeled 1.5-ml mi-

crocentrifuge tubes. Samples were eluted from the paper points by

placing them in 100 l of B-PER lysis buffer in a low-bind 1.5-ml

tube, flicking the tube at one flick per second for 30 s, discarding the

paper point, and snap-freezing the samples in liquid nitrogen. Each

plaque sample was processed in this manner separately but com-

bined for analysis. Twenty microliters of the eluate was used for

COR553 probe labeling, 5 l was used for BCA protein determina-

tion, and 2 l was used for qPCR.

qPCR detection of P. gingivalis copy number in saliva and

subgingival plaque of human subjects

DNA was extracted from 50 l of Saliva using Puregene Core Kit A

(Qiagen). The final DNA pellet was dissolved in 50 l of DNA hy-

dration buffer. A qPCR assay was performed with 2 l of saliva

DNA and hmuY primers [GAACGATTTGAACTGGGACA (H1.1

forward) and AACGGTAGTAGCCTGATCCA (H1.1 reverse)] and

a probe (/56-FAM/TTCTGTCTT/ZEN/GCCGGAGAATACGGC/

3IABkFQ/). A serial dilution of synthetic template DNA was in-

cluded in the qPCR assay to calculate the copy number of P. gingivalis

in saliva. qPCR was performed on 2 l of neat eluate of subgingival

plaque (no DNA extraction). The primers and methods were the

same as those used for saliva above.

Determination of Kgp-dependent growth of P. gingivalis

P. gingivalis [WT (ATCCBAA-308) and KgPIg-B] was inoculated

from stocks into 20 ml of prereduced modified TSB medium [TSB +

yeast extract (5 mg/ml),

l-cysteine (0.5 mg/ml), hemin (5 g/ml),

and vitamin K1 (1 g/ml)] and incubated at 37°C for 48 hours an-

aerobically in a Coy type C vinyl chamber. Prereduction of all solu-

tions used was done by transferring the liquids to an anaerobic

chamber for >16 hours immediately after autoclaving. On the day

of the experiment, the primary culture was diluted to obtain OD

of 0.2 to 0.25 using a Siemens MicroScan turbidity meter in the

prereduced modified TSB medium and incubated for 6 hours to

reach log phase (OD of approximately 0.5 to 0.6) at 37°C. Then, the

bacteria were collected by centrifuging at 4000 rpm for 10 min and

washed. Pellets were diluted to 3 × 10

to 5 × 10

CFU/ml, and 10 ml

of these diluted cultures was transferred into conical tubes and cen-

trifuged. The resultant pellet was resuspended using 10 ml of de-

fined medium to assess growth. The defined medium consists of the

following: salt base supplement [10.0 mM NaH

, 10.0 mM KCI,

2 mM citric acid, 1.25 mM MgCl

, 20.0 M CaCl

, 0.1 M Na

MoO

25.0 M ZnCl

, 50.0 M MnCl

, 5.0 M CuCl

, 10.0 M CoCl

, and

5.0 M H

(pH 7.0)] with 20 mM -ketoglutarate, 3% BSA, he-

min (5 g/ml), and vitamin K (1 g/ml). Fifty microliters of 100×

COR388 stock prepared in DMSO was added to the bacterial sus-

pension (3 × 10

to 5 × 10

CFU/ml) for each strain with a final

concentration of 500 nM. Vehicle cultures were treated with 0.1%

DMSO. The bacteria were incubated at 37°C in the anaerobic cham-

ber, and OD was measured at 0, 21, and 43 hours to generate a time

course of culture growth.

Assessment of in vitro resistance of P. gingivalis

P. gingivalis (ATCC BAA-308) and P. gingivalis Kgp knockout were

thawed, and a culture of OD

600

= 1.2 (equals 3 × 10

to 5 × 10

CFU/ml)

was prepared as described above. Resistance was assessed by incu-

bation of 16 serial passages of P. gingivalis in the defined medium

listed previously, and resistance to COR388 was performed simulta-

neously with cultures incubated with the broad-spectrum antibiotic

moxifloxacin. Because COR388 does not completely inhibit P. gingivalis

growth in vitro, we defined MIC as the minimum COR388 concen-

tration that produced a partial inhibition cutoff, specifically >50%

inhibition compared to nontreated cultures. Resistance was assessed

in two standard methods, with the final data reported as an average

of both methods. Cultures were first prepared with drug and moxi-

floxacin in a range of doses passaging each time for 17 passages and

monitoring MIC with each passage. In a separate study, drug con-

centrations were gradually increased between passages. The lowest

drug concentration that inhibited >50% growth was recorded as the

MIC, inoculum from this passage used for the next passage, and

assessed at a new drug concentration using the highest drug con-

centration that was sublethal and raising the concentrations through-

out the test as needed.

Statistical analysis

Data were analyzed with GraphPad Prism version 7.02 for Windows

(GraphPad Software, La Jolla, CA, USA; www.graphpad.com). Outliers

were detected with the ROUT method (Q = 0.2%) and removed from

further analysis. Outliers were not removed from data presented in

Fig.1. To determine whether the data were normally distributed, we

performed a Shapiro-Wilk test. If P values were below 0.05, then the

data were considered nonparametric and analyzed by Mann-Whitney

test or Kruskal-Wallis one-way analysis of variance (ANOVA) fol-

lowed by Dunn’s post hoc test. Parametric data were analyzed by

unpaired t test or by one-way ANOVA followed by Dunnett’s mul-

tiple comparisons test. Correlations were analyzed with Spearman’s

correlation coefficient.

SUPPLEMENTARY MATERIALS

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/

content/full/5/1/eaau3333/DC1

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

19 of 21

Fig. S1. CAB101 analysis of non-AD neurological disease brain microarrays.

Fig. S2. RgpB IHC in hippocampal samples from nondemented and AD patients.

Fig. S3. Sequencing of P. gingivalis hmuY PCR products from AD brains.

Fig. S4. Sequencing of P. gingivalis hmuY PCR products from clinical AD CSF.

Table S1. NVD003 AD and control TMA patient data.

Table S2. NVD005 AD and control TMA patient data.

Table S3. Tau fragments identified by MS after gingipain exposure.

Table S4. Demographic information of patients with CP who donated saliva and subgingival

plaque samples.

REFERENCES AND NOTES

1. T. Wyss-Coray, J. Rogers, Inflammation in Alzheimer disease—A brief review of the

basic science and clinical literature. Cold Spring Harb. Perspect. Med. 2, a006346

(2012).

2. V. Kaushal, R. Dye, P. Pakavathkumar, B. Foveau, J. Flores, B. Hyman, B. Ghetti, B. H. Koller,

A. C. LeBlanc, Neuronal NLRP1 inflammasome activation of Caspase-1 coordinately

regulates inflammatory interleukin-1-beta production and axonal degeneration-

associated Caspase-6 activation. Cell Death Differ. 22, 1676–1686 (2015).

3. F. Mawanda, R. Wallace, Can infections cause Alzheimer's disease? Epidemiol. Rev. 35,

161–180 (2013).

4. D. K. V. Kumar, S. H. Choi, K. J. Washicosky, W. A. Eimer, S. Tucker, J. Ghofrani, A. Lefkowitz,

G. McColl, L. E. Goldstein, R. E. Tanzi, R. D. Moir, Amyloid- peptide protects against

microbial infection in mouse and worm models of Alzheimer’s disease. Sci. Transl. Med. 8,

340ra72 (2016).

5. S. J. Soscia, J. E. Kirby, K. J. Washicosky, S. M. Tucker, M. Ingelsson, B. Hyman, M. A. Burton,

L. E. Goldstein, S. Duong, R. E. Tanzi, R. D. Moir, The Alzheimer’s disease-associated

amyloid -protein is an antimicrobial peptide. PLOS ONE 5, e9505 (2010).

6. P. Spitzer, M. Condic, M. Herrmann, T. J. Oberstein, M. Scharin-Mehlmann, D. F. Gilbert,

O. Friedrich, T. Grömer, J. Kornhuber, R. Lang, J. M. Maler, Amyloidogenic amyloid--

peptide variants induce microbial agglutination and exert antimicrobial activity. Sci. Rep.

6, 32228 (2016).

7. R. P. Darveau, G. Hajishengallis, M. A. Curtis, Porphyromonas gingivalis as a potential

community activist for disease. J. Dent. Res. 91, 816–820 (2012).

8. E. K. Kaye, A. Valencia, N. Baba, A. Spiro III, T. Dietrich, R. I. Garcia, Tooth loss and

periodontal disease predict poor cognitive function in older men. J. Am. Geriatr. Soc. 58,

713–718 (2010).

9. M. Gatz, J. A. Mortimer, L. Fratiglioni, B. Johansson, S. Berg, C. A. Reynolds, N. L. Pedersen,

Potentially modifiable risk factors for dementia in identical twins. Alzheimers Dement. 2,

110–117 (2006).

10. P. S. Stein, M. Desrosiers, S. J. Donegan, J. F. Yepes, R. J. Kryscio, Tooth loss, dementia and

neuropathology in the Nun study. J. Am. Dent. Assoc. 138, 1314–1322; quiz 1381–2

(2007).

11. A. R. Kamer, E. Pirraglia, W. Tsui, H. Rusinek, S. Vallabhajosula, L. Mosconi, L. Yi, P. McHugh,

R. G. Craig, S. Svetcov, R. Linker, C. Shi, L. Glodzik, S. Williams, P. Corby, D. Saxena,

M. J. de Leon, Periodontal disease associates with higher brain amyloid load in normal

elderly. Neurobiol. Aging 36, 627–633 (2015).

12. J. M. Noble, L. N. Borrell, P. N. Papapanou, M. S. V. Elkind, N. Scarmeas, C. B. Wright,

Periodontitis is associated with cognitive impairment among older adults: Analysis of

NHANES-III. J. Neurol. Neurosurg. Psychiatry 80, 1206–1211 (2009).

13. M. Ide, M. Harris, A. Stevens, R. Sussams, V. Hopkins, D. Culliford, J. Fuller, P. Ibbett,

R. Raybould, R. Thomas, U. Puenter, J. Teeling, V. H. Perry, C. Holmes, Periodontitis and

cognitive decline in Alzheimer’s disease. PLOS ONE 11, e0151081 (2016).

14. S. Poole, S. K. Singhrao, S. Chukkapalli, M. Rivera, I. Velsko, L. Kesavalu, S. Crean, Active

invasion of porphyromonas gingivalis and infection-induced complement activation in

ApoE

−/−

mice brains. J. Alzheimers Dis. 43, 67–80 (2015).

15. N. Ishida, Y. Ishihara, K. Ishida, H. Tada, Y. Funaki-Kato, M. Hagiwara, T. Ferdous,

M. Abdullah, A. Mitani, M. Michikawa, K. Matsushita, Periodontitis induced by bacterial

infection exacerbates features of Alzheimer’s disease in transgenic mice. NPJ Aging

Mech. Dis. 3, 15 (2017).

16. S. Poole, S. K. Singhrao, L. Kesavalu, M. A. Curtis, S. Crean, Determining the presence of

periodontopathic virulence factors in short-term postmortem Alzheimer’s disease brain

tissue. J. Alzheimers Dis. 36, 665–677 (2013).

17. S. K. Singhrao, A. Harding, S. Poole, L. Kesavalu, S. Crean, Porphyromonas gingivalis

periodontal infection and its putative links with Alzheimer’s disease. Mediators Inflamm.

2015, 137357 (2015).

18. A. L. Griffen, M. R. Becker, S. R. Lyons, M. L. Moeschberger, E. J. Leys, Prevalence of

Porphyromonas gingivalis and periodontal health status. J. Clin. Microbiol. 36, 3239–3242

(1998).

19. L. Forner, T. Larsen, M. Kilian, P. Holmstrup, Incidence of bacteremia after chewing, tooth

brushing and scaling in individuals with periodontal inflammation. J. Clin. Periodontol.

33, 401–407 (2006).

20. J. Mahendra, L. Mahendra, V. M. Kurian, K. Jaishankar, R. Mythilli, Prevalence of

periodontal pathogens in coronary atherosclerotic plaque of patients undergoing

coronary artery bypass graft surgery. J. Maxillofac. Oral Surg. 8, 108–113 (2009).

21. J. Katz, N. Chegini, K. T. Shiverick, R. J. Lamont, Localization of P. gingivalis in preterm

delivery placenta. J. Dent. Res. 88, 575–578 (2009).

22. M. Ishikawa, K. Yoshida, H. Okamura, K. Ochiai, H. Takamura, N. Fujiwara, K. Ozaki, Oral

Porphyromonas gingivalis translocates to the liver and regulates hepatic glycogen

synthesis through the Akt/GSK-3 signaling pathway. Biochim. Biophys. Acta 1832,

2035–2043 (2013).

23. J.-L. C. Mougeot, C. B. Stevens, B. J. Paster, M. T. Brennan, P. B. Lockhart, F. K. B. Mougeot,

Porphyromonas gingivalis is the most abundant species detected in coronary and femoral

arteries. J. Oral Microbiol. 9, 1281562 (2017).

24. Y. Guo, K.-A. Nguyen, J. Potempa, Dichotomy of gingipains action as virulence factors:

From cleaving substrates with the precision of a surgeon’s knife to a meat chopper-like

brutal degradation of proteins. Periodontol. 2000 54, 15–44 (2010).

25. M. J. Gui, S. G. Dashper, N. Slakeski, Y.-Y. Chen, E. C. Reynolds, Spheres of influence:

Porphyromonas gingivalis outer membrane vesicles. Mol. Oral Microbiol. 31, 365–378

(2016).

26. D. Grenier, S. Roy, F. Chandad, P. Plamondon, M. Yoshioka, K. Nakayama, D. Mayrand,

Effect of inactivation of the Arg- and/or Lys-gingipain gene on selected virulence and

physiological properties of Porphyromonas gingivalis. Infect. Immun. 71, 4742–4748

(2003).

27. P. G. Stathopoulou, J. C. Galicia, M. R. Benakanakere, C. A. Garcia, J. Potempa, D. F. Kinane,

Porphyromonas gingivalis induce apoptosis in human gingival epithelial cells through a

gingipain-dependent mechanism. BMC Microbiol. 9, 107 (2009).

28. S. M. Sheets, J. Potempa, J. Travis, C. A. Casiano, H. M. Fletcher, Gingipains from

Porphyromonas gingivalis W83 induce cell adhesion molecule cleavage and apoptosis in

endothelial cells. Infect. Immun. 73, 1543–1552 (2005).

29. J. A. Kinane, M. R. Benakanakere, J. Zhao, K. B. Hosur, D. F. Kinane, Porphyromonas

gingivalis influences actin degradation within epithelial cells during invasion and

apoptosis. Cell. Microbiol. 14, 1085–1096 (2012).

30. T. F. Flemmig, E. Milián, H. Karch, B. Klaiber, Differential clinical treatment outcome after

systemic metronidazole and amoxicillin in patients harboring Actinobacillus

actinomycetemcomitans and/or Porphyromonas gingivalis. J. Clin. Periodontol. 25,

380–387 (1998).

31. J. Travis, J. Potempa, Bacterial proteinases as targets for the development of second-

generation antibiotics. Biochim. Biophys. Acta 1477, 35–50 (2000).

32. A. E. Clatworthy, E. Pierson, D. T. Hung, Targeting virulence: A new paradigm for

antimicrobial therapy. Nat. Chem. Biol. 3, 541–548 (2007).

33. C. T. Supuran, A. Scozzafava, A. Mastrolorenzo, Bacterial proteases: Current therapeutic

use and future prospects for the development of new antibiotics. Expert Opin. Ther. Pat.

11, 221–259 (2001).

34. T. Kadowaki, A. Baba, N. Abe, R. Takii, M. Hashimoto, T. Tsukuba, S. Okazaki, Y. Suda,

T. Asao, K. Yamamoto, Suppression of pathogenicity of Porphyromonas gingivalis by

newly developed gingipain inhibitors. Mol. Pharmacol. 66, 1599–1606 (2004).

35. P. T. Nelson, I. Alafuzoff, E. H. Bigio, C. Bouras, H. Braak, N. J. Cairns, R. J. Castellani,

B. J. Crain, P. Davies, K. Del Tredici, C. Duyckaerts, M. P. Frosch, V. Haroutunian,

P. R. Hof, C. M. Hulette, B. T. Hyman, T. Iwatsubo, K. A. Jellinger, G. A. Jicha, E. Kovari,

W. A. Kukull, J. B. Leverenz, S. Love, I. R. Mackenzie, D. M. Mann, E. Masliah, A. C. McKee,

T. J. Montine, J. C. Morris, J. A. Schneider, J. A. Sonnen, D. R. Thal, J. Q. Trojanowski,

J. C. Troncoso, T. Wisniewski, R. L. Woltjer, T. G. Beach, Correlation of Alzheimer disease

neuropathologic changes with cognitive status: A review of the literature. J. Neuropathol.

Exp. Neurol. 71, 362–381 (2012).

36. A. Hershko, A. Ciechanover, The ubiquitin system. Annu. Rev. Biochem. 67, 425–479

(1998).

37. C. T. Chu, J. L. Caruso, T. J. Cummings, J. Ervin, C. Rosenberg, C. M. Hulette, Ubiquitin

immunochemistry as a diagnostic aid for community pathologists evaluating patients

who have dementia. Mod. Pathol. 13, 420–426 (2000).

38. R. Sperling, E. Mormino, K. Johnson, The evolution of preclinical Alzheimer’s disease:

Implications for prevention trials. Neuron 84, 608–622 (2014).

39. J. Potempa, K.-A. Nguyen, Purification and characterization of gingipains. Curr. Protoc.

Protein Sci. Chapter 21, Unit 21.20 (2007).

40. J. Potempa, R. Pike, J. Travis, The multiple forms of trypsin-like activity present in various

strains of Porphyromonas gingivalis are due to the presence of either Arg-gingipain or

Lys-gingipain. Infect. Immun. 63, 1176–1182 (1995).

41. A. Gmiterek, H. Wójtowicz, P. Mackiewicz, M. Radwan-Oczko, M. Kantorowicz,

M. Chomyszyn-Gajewska, M. Frąszczak, M. Bielecki, M. Olczak, T. Olczak, The unique hmuY

gene sequence as a specific marker of Porphyromonas gingivalis. PLOS ONE 8, e67719

(2013).

42. B. Linz, F. Balloux, Y. Moodley, A. Manica, H. Liu, P. Roumagnac, D. Falush, C. Stamer,

F. Prugnolle, S. W. van der Merwe, Y. Yamaoka, D. Y. Graham, E. Perez-Trallero,

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

20 of 21

T. Wadstrom, S. Suerbaum, M. Achtman, An African origin for the intimate association

between humans and Helicobacter pylori. Nature 445, 915–918 (2007).

43. C. Schabereiter-Gurtner, A. M. Hirschl, B. Dragosics, P. Hufnagl, S. Puz, Z. Kovách,

M. Rotter, A. Makristathis, Novel real-time PCR assay for detection of Helicobacter pylori

infection and simultaneous clarithromycin susceptibility testing of stool and biopsy

specimens. J. Clin. Microbiol. 42, 4512–4518 (2004).

44. S. S. Spudich, A. C. Nilsson, N. D. Lollo, T. J. Liegler, C. J. Petropoulos, S. G. Deeks,

E. E. Paxinos, R. W. Price, Cerebrospinal fluid HIV infection and pleocytosis: Relation to

systemic infection and antiretroviral treatment. BMC Infect. Dis. 5, 98 (2005).

45. Y. Yamamoto, PCR in diagnosis of infection: Detection of bacteria in cerebrospinal fluids.

Clin. Diagn. Lab. Immunol. 9, 508–514 (2002).

46. M. J. Espy, J. R. Uhl, L. M. Sloan, S. P. Buckwalter, M. F. Jones, E. A. Vetter, J. D. C. Yao,

N. L. Wengenack, J. E. Rosenblatt, F. R. Cockerill III, T. F. Smith, Real-time PCR in clinical

microbiology: Applications for routine laboratory testing. Clin. Microbiol. Rev. 19,

165–256 (2006).

47. H. Yin, J. Kuret, C-terminal truncation modulates both nucleation and extension phases

of  fibrillization. FEBS Lett. 580, 211–215 (2006).

48. B. Kovacech, M. Novak, Tau truncation is a productive posttranslational modification of

neurofibrillary degeneration in Alzheimer’s disease. Curr. Alzheimer Res. 7, 708–716

(2010).

49. S. Taniguchi-Watanabe, T. Arai, F. Kametani, T. Nonaka, M. Masuda-Suzukake, A. Tarutani,

S. Murayama, Y. Saito, K. Arima, M. Yoshida, H. Akiyama, A. Robinson, D. M. A. Mann,

T. Iwatsubo, M. Hasegawa, Biochemical classification of tauopathies by immunoblot,

protein sequence and mass spectrometric analyses of sarkosyl-insoluble and

trypsin-resistant tau. Acta Neuropathol. 131, 267–280 (2016).

50. D. Uberti, C. Rizzini, P. F. Spano, M. Memo, Characterization of tau proteins in human

neuroblastoma SH-SY5Y cell line. Neurosci. Lett. 235, 149–153 (1997).

51. T. McAvoy, M. E. Lassman, D. S. Spellman, Z. Ke, B. J. Howell, O. Wong, L. Zhu, M. Tanen,

A. Struyk, O. F. Laterza, Quantification of tau in cerebrospinal fluid by immunoaffinity

enrichment and tandem mass spectrometry. Clin. Chem. 60, 683–689 (2014).

52. C. Sato, N. R. Barthélemy, K. G. Mawuenyega, B. W. Patterson, B. A. Gordon,

J. Jockel-Balsarotti, M. Sullivan, M. J. Crisp, T. Kasten, K. M. Kirmess, N. M. Kanaan,

K. E. Yarasheski, A. Baker-Nigh, T. L. S. Benzinger, T. M. Miller, C. M. Karch, R. J. Bateman,

Tau kinetics in neurons and the human central nervous system. Neuron 97, 1284–1298.e7

(2018).

53. M. von Bergen, P. Friedhoff, J. Biernat, J. Heberle, E.-M. Mandelkow, E. Mandelkow,

Assembly of  protein into Alzheimer paired helical filaments depends on a local

sequence motif (

306

VQIVYK

311

) forming  structure. Proc. Natl. Acad. Sci. U.S.A. 97,

5129–5134 (2000).

54. J. Stöhr, H. Wu, M. Nick, Y. Wu, M. Bhate, C. Condello, N. Johnson, J. Rodgers, T. Lemmin,

S. Acharya, J. Becker, K. Robinson, M. J. S. Kelly, F. Gai, G. Stubbs, S. B. Prusiner,

W. F. DeGrado, A 31-residue peptide induces aggregation of tau’s microtubule-binding

region in cells. Nat. Chem. 9, 874–881 (2017).

55. S. Eick, W. Pfister, Efficacy of antibiotics against periodontopathogenic bacteria within

epithelial cells: An in vitro study. J. Periodontol. 75, 1327–1334 (2004).

56. E. Portelius, H. Zetterberg, R. A. Dean, A. Marcil, P. Bourgeois, M. Nutu, U. Andreasson,

E. Siemers, K. G. Mawuenyega, W. C. Sigurdson, P. C. May, S. M. Paul, D. M. Holtzman,

K. Blennow, R. J. Bateman, Amyloid-

1–15/16

as a marker for -secretase inhibition in

Alzheimer’s disease. J. Alzheimers Dis. 31, 335–341 (2012).

57. M. Sztukowska, A. Sroka, M. Bugno, A. Banbula, Y. Takahashi, R. N. Pike, C. A. Genco,

J. Travis, J. Potempa, The C-terminal domains of the gingipain K polyprotein are

necessary for assembly of the active enzyme and expression of associated activities.

Mol. Microbiol. 54, 1393–1408 (2004).

58. K.-A. Nguyen, J. Travis, J. Potempa, Does the importance of the C-terminal residues in the

maturation of RgpB from Porphyromonas gingivalis reveal a novel mechanism for protein

export in a subgroup of Gram-Negative bacteria? J. Bacteriol. 189, 833–843 (2007).

59. K. Govindpani, B. Calvo-Flores Guzman, C. Vinnakota, H. J. Waldvogel, R. L. Faull,

A. Kwakowsky, Towards a better understanding of GABAergic remodeling in Alzheimer’s

disease. Int. J. Mol. Sci. 18, E1813 (2017).

60. W. Fornicola, A. Pelcovits, B.-X. Li, J. Heath, G. Perry, R. J. Castellani, Alzheimer disease

pathology in middle age reveals a spatial-temporal disconnect between amyloid- and

phosphorylated tau. Open Neurol. J. 8, 22–26 (2014).

61. J. C. Lenzo, N. M. O’Brien-Simpson, R. K. Orth, H. L. Mitchell, S. G. Dashper, E. C. Reynolds,

Porphyromonas gulae has virulence and immunological characteristics similar to those of

the human periodontal pathogen Porphyromonas gingivalis. Infect. Immun. 84,

2575–2585 (2016).

62. Y. Yamasaki, R. Nomura, K. Nakano, S. Naka, M. Matsumoto-Nakano, F. Asai, T. Ooshima,

Distribution of periodontopathic bacterial species in dogs and their owners. Arch. Oral

Biol. 57, 1183–1188 (2012).

63. L. Sun, R. Zhou, G. Yang, Y. Shi, Analysis of 138 pathogenic mutations in presenilin-1 on

the in vitro production of A42 and A40 peptides by -secretase. Proc. Natl. Acad.

Sci. U.S.A. 114, E476–E485 (2017).

64. R. Zhou, G. Yang, Y. Shi, Dominant negative effect of the loss-of-function -secretase

mutants on the wild-type enzyme through heterooligomerization. Proc. Natl. Acad.

Sci. U.S.A. 114, 12731–12736 (2017).

65. W. B. Zigman, D. A. Devenny, S. J. Krinsky-McHale, E. C. Jenkins, T. K. Urv, J. Wegiel,

N. Schupf, W. Silverman, Alzheimer’s disease in adults with Down syndrome. Int. Rev. Res.

Ment. Retard. 36, 103–145 (2008).

66. P. J. Cichon, L. B. Crawford, W. D. Grimm, Early-onset periodontitis associated with

Down’s syndrome—Clinical interventional study. Ann. Periodontol. 3, 370–380 (1998).

67. A. Amano, T. Kishima, S. Kimura, M. Takiguchi, T. Ooshima, S. Hamada, I. Morisaki,

Periodontopathic bacteria in children with Down syndrome. J. Periodontol. 71, 249–255

(2000).

68. G. Ram, J. Chinen, Infections and immunodeficiency in Down syndrome. Clin. Exp.

Immunol. 164, 9–16 (2011).

69. M. B. Giacona, P. N. Papapanou, I. B. Lamster, L. L. Rong, V. D. D’Agati, A. M. Schmidt,

E. Lalla, Porphyromonas gingivalis induces its uptake by human macrophages and

promotes foam cell formation in vitro. FEMS Microbiol. Lett. 241, 95–101 (2004).

70. M. Coureuil, H. Lécuyer, S. Bourdoulous, X. Nassif, A journey into the brain: Insight into

how bacterial pathogens cross blood-brain barriers. Nat. Rev. Microbiol. 15, 149–159

(2017).

71. B. R. Talamo, W.-H. Feng, M. Perez-Cruet, L. Adelman, K. Kosik, V. M.-Y. Lee, L. C. Cork,

J. S. Kauer, Pathologic changes in olfactory neurons in Alzheimer’s disease. Ann. N. Y.

Acad. Sci. 640, 1–7 (1991).

72. L. Li, R. Michel, J. Cohen, A. DeCarlo, E. Kozarov, Intracellular survival and vascular

cell-to-cell transmission of Porphyromonas gingivalis. BMC Microbiol. 8, 26 (2008).

73. T. E. Cope, T. Rittman, R. J. Borchert, P. S. Jones, D. Vatansever, K. Allinson, L. Passamonti,

P. Vazquez Rodriguez, W. R. Bevan-Jones, J. T. O’Brien, J. B. Rowe, Tau burden and the

functional connectome in Alzheimer’s disease and progressive supranuclear palsy. Brain

141, 550–567 (2018).

74. S. Urnowey, T. Ansai, V. Bitko, K. Nakayama, T. Takehara, S. Barik, Temporal activation of

anti- and pro-apoptotic factors in human gingival fibroblasts infected with the

periodontal pathogen, Porphyromonas gingivalis: Potential role of bacterial proteases in

host signalling. BMC Microbiol. 6, 26 (2006).

75. J. Chu, E. Lauretti, D. Praticò, Caspase-3-dependent cleavage of Akt modulates tau

phosphorylation via GSK3 kinase: Implications for Alzheimer’s disease. Mol. Psychiatry

22, 1002–1008 (2017).

76. P. Sandhu, M. M. Naeem, C. Lu, P. Kumarathasan, J. Gomes, A. Basak, Ser

422

phosphorylation blocks human Tau cleavage by caspase-3: Biochemical implications

to Alzheimer’s Disease. Bioorg. Med. Chem. Lett. 27, 642–652 (2017).

77. E. H. Corder, A. M. Saunders, W. J. Strittmatter, D. E. Schmechel, P. C. Gaskell,

G. W. Small, A. D. Roses, J. L. Haines, M. A. Pericak-Vance, Gene dose of apolipoprotein

E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261,

921–923 (1993).

78. S. E. Roselaar, A. Daugherty, Apolipoprotein E-deficient mice have impaired innate

immune responses to Listeria monocytogenes in vivo. J. Lipid Res. 39, 1740–1743 (1998).

79. J. Lönn, S. Ljunggren, K. Klarström-Engström, I. Demirel, T. Bengtsson, H. Karlsson,

Lipoprotein modifications by gingipains of Porphyromonas gingivalis. J. Periodontal Res.

53, 403–413 (2018).

80. F. M. Harris, W. J. Brecht, Q. Xu, I. Tesseur, L. Kekonius, T. Wyss-Coray, J. D. Fish, E. Masliah,

P. C. Hopkins, K. Scearce-Levie, K. H. Weisgraber, L. Mucke, R. W. Mahley, Y. Huang,

Carboxyl-terminal-truncated apolipoprotein E4 causes Alzheimer’s disease-like

neurodegeneration and behavioral deficits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A.

100, 10966–10971 (2003).

81. T. R. Jay, V. E. von Saucken, G. E. Landreth, TREM2 in neurodegenerative diseases.

Mol. Neurodegener. 12, 56 (2017).

82. P. Minoretti, C. Gazzaruso, C. D. Vito, E. Emanuele, M. P. Bianchi, E. Coen, M. Reino,

D. Geroldi, Effect of the functional toll-like receptor 4 Asp299Gly polymorphism on

susceptibility to late-onset Alzheimer’s disease. Neurosci. Lett. 391, 147–149 (2006).

83. N. Brouwers, C. Van Cauwenberghe, S. Engelborghs, J.-C. Lambert, K. Bettens,

N. Le Bastard, F. Pasquier, A. G. Montoya, K. Peeters, M. Mattheijssens, R. Vandenberghe,

P. P. Deyn, M. Cruts, P. Amouyel, K. Sleegers, C. Van Broeckhoven, Alzheimer risk

associated with a copy number variation in the complement receptor 1 increasing

C3b/C4b binding sites. Mol. Psychiatry 17, 223–233 (2012).

84. M.-S. Tan, J.-T. Yu, T. Jiang, X.-C. Zhu, H.-F. Wang, W. Zhang, Y.-L. Wang, W. Jiang, L. Tan,

NLRP3 polymorphisms are associated with late-onset Alzheimer’s disease in Han

Chinese. J. Neuroimmunol. 265, 91–95 (2013).

85. X. Gao, Y. Dong, Z. Liu, B. Niu, Silencing of triggering receptor expressed on myeloid

cells-2 enhances the inflammatory responses of alveolar macrophages to

lipopolysaccharide. Mol. Med. Rep. 7, 921–926 (2013).

86. E.-N. N’Diaye, C. S. Branda, S. S. Branda, L. Nevarez, M. Colonna, C. Lowell, J. A. Hamerman,

W. E. Seaman, TREM-2 (triggering receptor expressed on myeloid cells 2) is a phagocytic

receptor for bacteria. J. Cell Biol. 184, 215–223 (2009).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

Dominy et al., Sci. Adv. 2019; 5 : eaau3333 23 January 2019

SCIENCE ADVANCES

RESEARCH ARTICLE

21 of 21

87. J. M. Replogle, G. Chan, C. C. White, T. Raj, P. A. Winn, D. A. Evans, R. A. Sperling,

L. B. Chibnik, E. M. Bradshaw, J. A. Schneider, D. A. Bennett, P. L. De Jager, A TREM1

variant alters the accumulation of Alzheimer-related amyloid pathology. Ann. Neurol. 77,

469–477 (2015).

88. N. Bostanci, T. Thurnheer, J. Aduse-Opoku, M. A. Curtis, A. S. Zinkernagel, G. N. Belibasakis,

Porphyromonas gingivalis regulates TREM-1 in human polymorphonuclear neutrophils

via its gingipains. PLOS ONE 8, e75784 (2013).

89. F. Martinon, J. Tschopp, Inflammatory caspases: Linking an intracellular innate immune

system to autoinflammatory diseases. Cell 117, 561–574 (2004).

90. M. Saresella, F. La Rosa, F. Piancone, M. Zoppis, I. Marventano, E. Calabrese, V. Rainone,

R. Nemni, R. Mancuso, M. Clerici, The NLRP3 and NLRP1 inflammasomes are activated in

Alzheimer’s disease. Mol. Neurodegener. 11, 23 (2016).

91. I. Olsen, Ö. Yilmaz, Modulation of inflammasome activity by Porphyromonas gingivalis in

periodontitis and associated systemic diseases. J. Oral Microbiol. 8, 30385 (2016).

92. C. Venegas, S. Kumar, B. S. Franklin, T. Dierkes, R. Brinkschulte, D. Tejera, A. Vieira-Saecker,

S. Schwartz, F. Santarelli, M. P. Kummer, A. Griep, E. Gelpi, M. Beilharz, D. Riedel,

D. T. Golenbock, M. Geyer, J. Walter, E. Latz, M. T. Heneka, Microglia-derived ASC specks

cross-seed amyloid- in Alzheimer’s disease. Nature 552, 355–361 (2017).

93. M. T.-H. Huang, D. J. Taxman, E. A. Holley-Guthrie, C. B. Moore, S. B. Willingham,

V. Madden, R. K. Parsons, G. L. Featherstone, R. R. Arnold, B. P. O’Connor, J. P.-Y. Ting,

Critical role of apoptotic speck protein containing a caspase recruitment domain (ASC)

and NLRP3 in causing necrosis and ASC speck formation induced by Porphyromonas

gingivalis in human cells. J. Immunol. 182, 2395–2404 (2009).

94. S. Mariathasan, D. S. Weiss, V. M. Dixit, D. M. Monack, Innate immunity against

Francisella tularensis is dependent on the ASC/caspase-1 axis. J. Exp. Med. 202,

1043–1049 (2005).

95. T. N. Ellis, M. J. Kuehn, Virulence and immunomodulatory roles of bacterial outer

membrane vesicles. Microbiol. Mol. Biol. Rev. 74, 81–94 (2010).

96. J. D. Cecil, N. M. O’Brien-Simpson, J. C. Lenzo, J. A. Holden, W. Singleton, A. Perez-Gonzalez,

A. Mansell, E. C. Reynolds, Outer membrane vesicles prime and activate macrophage

inflammasomes and cytokine secretion in vitro and in vivo. Front. Immunol. 8, 1017

(2017).

97. A. J. Fleetwood, M. K. S. Lee, W. Singleton, A. Achuthan, M.-C. Lee, N. M. O’Brien-Simpson,

A. D. Cook, A. J. Murphy, S. G. Dashper, E. C. Reynolds, J. A. Hamilton, Metabolic

remodeling, inflammasome activation, and pyroptosis in macrophages stimulated by

Porphyromonas gingivalis and its outer membrane vesicles. Front. Cell. Infect. Microbiol. 7,

351 (2017).

98. Y. Zhao, F. Shao, Diverse mechanisms for inflammasome sensing of cytosolic bacteria

and bacterial virulence. Curr. Opin. Microbiol. 29, 37–42 (2016).

99. K. O. Bender, M. Garland, J. A. Ferreyra, A. J. Hryckowian, M. A. Child, A. W. Puri,

D. E. Solow-Cordero, S. K. Higginbottom, E. Segal, N. Banaei, A. Shen, J. L. Sonnenburg,

M. Bogyo, A small-molecule antivirulence agent for treating Clostridium difficile infection.

Sci. Transl. Med. 7, 306ra148 (2015).

100. Y. Shi, D. B. Ratnayake, K. Okamoto, N. Abe, K. Yamamoto, K. Nakayama, Genetic analyses

of proteolysis, hemoglobin binding, and hemagglutination of Porphyromonas gingivalis.

Construction of mutants with a combination of rgpA, rgpB, kgp, and hagA. J. Biol. Chem.

274, 17955–17960 (1999).

101. J. W. Smalley, A. J. Birss, B. Szmigielski, J. Potempa, Sequential action of R- and K-specific

gingipains of Porphyromonas gingivalis in the generation of the haem-containing

pigment from oxyhaemoglobin. Arch. Biochem. Biophys. 465, 44–49 (2007).

102. R. D. Pathirana, N. M. O’Brien-Simpson, G. C. Brammar, N. Slakeski, E. C. Reynolds, Kgp and

RgpB, but not RgpA, are important for Porphyromonas gingivalis virulence in the murine

periodontitis model. Infect. Immun. 75, 1436–1442 (2007).

103. C. L. Ventola, The antibiotic resistance crisis: Part 1: Causes and threats. P. T. 40, 277–283

(2015).

104. J. H. Kwon, M. A. Olsen, E. R. Dubberke, The morbidity, mortality, and costs associated

with Clostridium difficile infection. Infect. Dis. Clin. North Am. 29, 123–134 (2015).

105. P. J. Narayan, S.-L. Kim, C. Lill, S. Feng, R. L. M. Faull, M. A. Curtis, M. Dragunow, Assessing

fibrinogen extravasation into Alzheimer’s disease brain using high-content screening of

brain tissue microarrays. J. Neurosci. Methods 247, 41–49 (2015).

106. H. C. Kolb, M. G. Finn, K. B. Sharpless, Click chemistry: Diverse chemical function from a

few good reactions. Angew. Chem. Int. Ed. 40, 2004–2021 (2001).

107. J. L. Poirier, R. Čapek, Y. De Koninck, Differential progression of Dark Neuron and

Fluoro-Jade labelling in the rat hippocampus following pilocarpine-induced status

epilepticus. Neuroscience 97, 59–68 (2000).

108. J. M. Morillo, L. Lau, M. Sanz, D. Herrera, A. Silva, Quantitative real-time PCR based on

single copy gene sequence for detection of Actinobacillus actinomycetemcomitans and

Porphyromonas gingivalis. J. Periodontal Res. 38, 518–524 (2003).

Acknowledgments: We are enormously grateful to the brain tissue donors and their families.

We are also very grateful to N. Mehrabi, M. Singh-Bains, and S. Feng (Centre for Brain Research,

University of Auckland) for their expert assistance with TMA construction, IHC, and MetaMorph

analyses and to M. Eszes, the Human Brain Bank manager. Funding: P.M. was supported by

National Science Center 2016/23/B/NZ5/011469, Poland. J.P. was supported by NIH/NIDCR

grant R01DE022597. This work was funded by Cortexyme Inc. Author contributions: S.S.D.

and C.L. developed and coordinated the project, designed experiments, evaluated the data,

and drafted the manuscript. F.E. designed, performed, and analyzed IHC and

immunofluorescent experiments on human brain tissues; designed, performed, and analyzed

experiments on stereotactic injection of gingipains into mouse brain; designed, performed,

and analyzed experiments on the antibacterial effects of A on P. gingivalis; and analyzed brain

samples from all animal experiments. M.B. and A.M. designed, performed, and analyzed

experiments using a mouse model of P. gingivalis–induced periodontal disease

and brain infection. A.K. designed and oversaw the development of small-molecule gingipain

inhibitors. M.N. performed IP and WB of Kgp from human brain tissues. U.H. analyzed brain

samples from all animal experiments. D.R. designed, performed, and analyzed PCR

experiments of P. gingivalis DNA load in human CSF. C.G. performed in vitro digestion of

recombinant tau-441 by gingipains and developed the WB of tau proteolytic fragments. L.J.H.

and S.A.-K. designed and evaluated experiments and edited the manuscript. S.K. evaluated

experiments and edited the manuscript. A.L. assisted in biochemical aspects of the

experiments. M.I.R. evaluated experiments and edited the manuscript. B.P. provided purified

gingipains. P.M., A.H., and K.A. assisted in performing mouse experiments and analyzing

animal specimens. H.H. provided saliva and subgingival plaque samples from periodontal

subjects at The Forsyth Institute. G.D.W. and E.C.R. analyzed gingipain-IR in AD brain tissue at

the University of Melbourne and provided gingipain antibodies. R.L.M.F., M.A.C., and M.D.

coordinated experiments and analyzed brain TMAs using anti-gingipain antibodies at

NeuroValida, the University of Auckland. J.P. developed and coordinated the project, designed

experiments, evaluated the data, and helped draft the manuscript. Competing interests:

S.S.D. and C.L. are co-founders of Cortexyme, are employees of the company, and own

Cortexyme stock. F.E., M.N., U.H., D.R., C.G., L.J.H., S.A.-K., S.K., and A.L. are Cortexyme

employees with stock options. A.K. is a paid consultant of Cortexyme and owns Cortexyme

stock. M.I.R. and J.P. are scientific advisors to Cortexyme and have options to purchase

Cortexyme stock. A.K., S.S.D., and C.L. are inventors on two issued patents both entitled

“Inhibitors of lysine gingipain” (US/9,975,473 and US/9.988,375) as well as two pending

patent applications entitled “Inhibitors of arginine gingipain” (PCT/US2016/061197, filed on

9 November 2016) and “Ketone inhibitors of lysine gingipain” (PCT/US2017/051912, filed on

15 September 2017). S.S.D. and C.L. are inventors on a patent application entitled “Methods

of use for therapeutics targeting the pathogen P. gingivalis” (US2017/ 0014468, filed on

29 April 2015). A.K. and L.J.H. are inventors on a patent application entitled “Gingipain activity

probes” (62/459,456; filed on 15 February 2017). Cortexyme is the assignee of these patents

and applications. The other authors declare that they have no competing interests. Data and

materials availability: All data needed to evaluate the conclusions in the paper are present in

the paper and/or the Supplementary Materials. Additional data related to this paper may be

requested from the authors.

Submitted 30 May 2018

Accepted 11 December 2018

Published 23 January 2019

10.1126/sciadv.aau3333

Citation: S. S. Dominy, C. Lynch, F. Ermini, M. Benedyk, A. Marczyk, A. Konradi, M. Nguyen,

U. Haditsch, D. Raha, C. Griffin, L. J. Holsinger, S. Arastu-Kapur, S. Kaba, A. Lee, M. I. Ryder,

B. Potempa, P. Mydel, A. Hellvard, K. Adamowicz, H. Hasturk, G. D. Walker, E. C. Reynolds,

R. L. M. Faull, M. A. Curtis, M. Dragunow, J. Potempa, Porphyromonas gingivalis in Alzheimer’s

disease brains: Evidence for disease causation and treatment with small-molecule inhibitors.

Sci. Adv. 5, eaau3333 (2019).

on January 17, 2020http://advances.sciencemag.org/Downloaded from

treatment with small-molecule inhibitors

in Alzheimer's disease brains: Evidence for disease causation andPorphyromonas gingivalis

Reynolds, Richard L. M. Faull, Maurice A. Curtis, Mike Dragunow and Jan Potempa

Ryder, Barbara Potempa, Piotr Mydel, Annelie Hellvard, Karina Adamowicz, Hatice Hasturk, Glenn D. Walker, Eric C.

Haditsch, Debasish Raha, Christina Griffin, Leslie J. Holsinger, Shirin Arastu-Kapur, Samer Kaba, Alexander Lee, Mark I.

Stephen S. Dominy, Casey Lynch, Florian Ermini, Malgorzata Benedyk, Agata Marczyk, Andrei Konradi, Mai Nguyen, Ursula

DOI: 10.1126/sciadv.aau3333

(1), eaau3333.5Sci Adv

ARTICLE TOOLS

http://advances.sciencemag.org/content/5/1/eaau3333

MATERIALS

SUPPLEMENTARY

http://advances.sciencemag.org/content/suppl/2019/01/18/5.1.eaau3333.DC1

REFERENCES

http://advances.sciencemag.org/content/5/1/eaau3333#BIBL

This article cites 108 articles, 27 of which you can access for free

PERMISSIONS

http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.Science AdvancesYork Avenue NW, Washington, DC 20005. The title

(ISSN 2375-2548) is published by the American Association for the Advancement of Science, 1200 NewScience Advances

BY).

Science. No claim to original U.S. Government Works. Distributed under a Creative Commons Attribution License 4.0 (CC

on January 17, 2020http://advances.sciencemag.org/Downloaded from

This was a multi-institution study, and the first authors are from the publicly traded company that has developed a small-molecule inhibitor for Alzheimers that is still going through clinical trials: Cortexyme (https://www.cortexyme.com/). Periodontal disease, is an infection of the tissues that hold your teeth in place that is caused by poor dental hygiene that allow plaque (which are a sticky film of bacteria) to accumulate on teeth and harden. For more about Periodontal disease: https://www.nidcr.nih.gov/health-info/gum-disease/more-info It is also important to note (as a limitation), that there is a difference between the permeability of the brain-blood barriers of individuals with and without Alzheimers, and individuals with the disease, are more susceptible to getting infections in their brains. Here is a video from the company leading this study, Cortexyme, discussing their small molecule inhibitor: https://vimeo.com/333736696 It is important to note the point that P. gingivalis is also found in individuals with no oral disease, and in individuals with oral disease but without Alzheimers disease. In this paper, the authors find evidence that the bacteria Porphyromonas gingivalis, which is associated with chronic gum diseases, is involved in the pathology of Alzheimers, and they introduce a potential treatment using small-molecule inhibitors. This study is groundbreaking for several reasons, not the least of which is the remarkable discovery of these pathogens in the brains of Alzheimer’s patients. Links between neurodegenerative diseases, brains and the microbiome, are bound to arise, and this paper has generated a lot of interest and funding in these directions. P. gingivalis has been previously shown to be significantly associated with cardiovascular disease, and knowledge of the link between plaques in teeth and plaques in arteries is well known by the cardiology community: https://www.health.harvard.edu/heart-health/gum-disease-and-heart-disease-the-common-thread Broad spectrum antibiotics cannot treat P. gingivalis, a motivation for the small molecule inhibitor in this study. Tau is one of the main biomarkers for AD. These key graphs demonstrate the presence of these P. gingivalis pathogens, and their correlation with Tau, and other Alzheimers biomarkers, in the brains of individuals with Alzheimers.

Comments

Products

Project