Fermat's Library | Inactive disease in patients with lupus is linked to autoantibodies to type I interferons that normalize blood IFNα and B cell subsets annotated/explained version.

Are all neutralizing IFNalpha Ab sub-types created equally? Do you ...

Can you speculate on the mechanisms that might govern whether or no...

Report

Inactive disease in patients with lupus is linked to

autoantibodies to type I interferons that normalize

blood IFNa and B cell subsets

Graphical abstract

Highlights

d 14% of patients with SLE harbor natural anti-IFNa-Abs

d Neutralizing anti-IFNa-Abs are associated with reduced

serum IFNa levels

d Neutralizing anti-IFNa-Abs are associated with reduced

disease activity

d Normalization of B cell subsets in patients with SLE with

neutralizing anti-IFNa-Abs

Authors

Hannah F. Bradford, Liis Haljasma

gi,

Madhvi Menon, ..., David A. Isenberg,

Kai Kisand, Claudia Mauri

Correspondence

hannah.bradford.12@ucl.ac.uk (H.F.B.),

madhvi.menon@manchester.ac.uk

(M.M.),

kai.kisand@ut.ee (K.K.),

c.mauri@ucl.ac.uk (C.M.)

In brief

Bradford et al. characterize the

prevalence of anti-IFNa-Abs in patients

with SLE and their association with serum

levels of IFNa, clinical parameters, and B

cell abnormalities. Patients with SLE

harboring autoantibodies that neutralize

IFNa show reduced serum IFNa levels

and ISG expression, disease severity, and

normalized B cell compartments.

Bradford et al., 2023, Cell Reports Medicine 4, 100894

January 17, 2023 Crown Copyright ª 2022

https://doi.org/10.1016/j.xcrm.2022.100894

Report

Inactive disease in patients with lupus is linked

to autoantibodies to type I interferons that

normalize blood IFNa and B cell subsets

Hannah F. Bradford,

1,2,7,

Liis Haljasma

gi,

3,7

Madhvi Menon,

4,7,

Thomas C.R. McDonnell,

Karita Sa

rekannu,

Martti Vanker,

rt Peterson,

Chris Wincup,

Rym Abida,

Raquel Fernandez Gonzalez,

Vincent Bondet,

Darragh Duffy,

David A. Isenberg,

Kai Kisand,

3,8,

and Claudia Mauri

1,2,8,9,

Division of Infection and Immunity and Institute of Immunity and Transplantation, Royal Free Hospital, University College London, London

NW3 2PP, UK

Centre for Rheumatology, Division of Medicine, University College London, London WC1E 6JF, UK

Institute of Biomedicine and Translational Medicine, University of Tartu, Tartu, Estonia

Lydia Becker Institute of Immunology and Inﬂammation, Division of Infection, Immunity & Respiratory Medicine, School of Biological

Sciences, University of Manchester, Manchester M13 9PL, UK

Department of Biochemical Engineering, University College London, London WC1E 6BT, UK

Translational Immunology Unit, Institut Pasteur, Universite

Paris Cite

, Paris, France

These authors contributed equally

Lead contact

*Correspondence: hannah.bradford.12@ucl.ac.uk (H.F.B.), madhvi.menon@manchester.ac.uk (M.M.), kai.kisand@ut.ee (K.K.), c.mauri@ucl.

ac.uk (C.M.)

https://doi.org/10.1016/j.xcrm.2022.100894

SUMMARY

Systemic lupus erythem atosus (SLE) is characterized by increased expression of type I interferon (IFN)-regu-

lated genes in 50%–75% of patients. We report that out of 501 patients with SLE analyzed, 73 (14%) present

autoantibodies against IFNa (anti-IFN-Abs). The presence of neutralizing-anti-IFN-Abs in 4.2% of patients

inversely correlates with low circulating IFNa protein levels, inhibition of IFN-I downstream gene signatures,

and inactive global disease score. Hallmarks of SLE pathogenesis, including increased immature, double-

negative plasmablast B cell populations and reduction in regulatory B cell (Breg) frequencies, were normal-

ized in patients with neutralizing anti-IFN-Abs compared with other patient groups. Immunoglobulin G (IgG)

puriﬁed from sera of patients with SLE with neutralizing anti-IFN-Abs impedes CpGC-driven IFNa-dep endent

differentiation of B cells into immature B cells and plasmablasts, thus recapitulating the neutralizing effect of

anti-IFN-Abs on B cell differentiation in vitro. Our ﬁndings highlight a role for neutralizing anti-IFN-Abs in con-

trolling SLE pathogenesis and support the use of IFN-targeting therapies in patients with SLE lacking neutral-

izing-anti-IFN-Abs.

INTRODUCTION

Systemic lupus erythematosus (SLE) is a heterogeneous autoim-

mune disease affecting multiple organ systems. Abnormal B cell

proportions including expansion of atypical memory, also known

as double-negative (DN) B cells, and autoantibody-secreting

plasma cells contribute to autoimmune inﬂammation and tissue

injury.

1–3

In addition to B cell dysfunction, 50%–75% of patients

with SLE present an upregulation of type I interferon (IFN-I)-stim-

ulated genes (ISGs) that directly correlate with disease severity.

The IFN-I family includes IFNb,IFNu,IFNε,IFNk, and 13 additional

subtypes of IFNa that bind to the same receptor, IFNAR.

We and

others have previously shown that a ﬁnely tuned IFNa response is

required to induce the differentiation of immature B cells into

plasma cells that produce antibodies during, for example, viral

infection, as well as regulatory B cells (Bregs) that restore homeo-

stasis.

5,6

In SLE, chronic IFNa production fuels autoimmunity by

promoting the differentiation of monocytes to dendritic cells

(DCs),

7,8

which activate autoreactive T cells; the generation of

effector and memory CD8

Tcells

9–11

; and the differentiation of

B cells into autoantibody-producing plasma cells but not

Bregs.

5,12

The pathogenic role of IFNa in SLE is supported by

several clinical observations. Patients with monogenic diseases,

including complement and FASL deﬁciency and TREX-1 muta-

tion, which all lead to IFN-I overproduction, display SLE-like

symptoms.

13–15

Patients treated with IFN-I for cancer and chronic

infections develop a lupus-like disease and/or anti-double-

stranded DNA (dsDNA) antibodies.

16,17

IFN-a kinoid vaccination

induces antibodies that cross-neutralize all IFNa subtypes, which

in 50% of immunized SLE patients has shown therapeutic efﬁ-

cacy.

IFN-I blockade has also been shown to be beneﬁcial in pa-

tients with SLE.

19,20

Cell Reports Medicine 4, 100894, January 17, 2023 Crown Copyright ª 2022 1

This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

OPEN ACCESS

Neutralizing autoantibodies to IFN-I has been reported to

develop in patients treated with IFNa2 or IFNb therapy

21,22

;in

the majority of patients with autoimmune polyendocrinopathy

syndrome type I (APS-1)

23,24

or thymoma

; at lower frequencies

in rheumatic diseases, including cross-sectional lupus co-

horts

26–28

; and more recently in a subset of patients with life-

threatening COVID-19.

29,30

Here, we showed that neutralizing autoantibodies against

IFNa (anti-IFN-I-Abs) cross-react with all IFNa subtypes in a

cross-sectional and longitudinal cohort of patients with SLE

and are associated with signiﬁcantly reduced levels of circulating

IFNa levels, disease activity, and restored B cell responses,

suggesting a disease-aggravating role for non-neutralizing

anti-IFN-Abs.

RESULTS

Neutralizing anti-IFN-Abs reduce circulating IFNa and

IFNa downstream signaling

To evaluate whether patients with SLE develop endogenous au-

toantibodies to IFNa or/and other cytokines, we tested sera from

474 patients with SLE and 312 healthy controls (controls) for au-

toantibodies (autoAbs) against cytokines with the luciferase

immunoprecipitation system (LIPS) assay (clinical characteristic,

genders, and ethnicities are reported in Table 1, and the study

population described in detail in the STAR Methods ). AutoAbs

to cytokines were measured in groups that included IFNa

(IFNa1, IFNa2, IFNa8, IFNa21); IFNu; IFNg; IFNb1; T helper 17

(Th17; IL-17A, IL-17F, IL-22); IFNl (IL-28A, IL-28B, IL-29); inter-

leukin (IL; IL-6, IL-7, IL-10, IL-15, IL-1b); and tumor necrosis fac-

tor (TNF; TNF, LTA, BAFF, APRIL) pools (Figure 1A; Table S2).

Most autoAbs to cytokines were either undetectable or pro-

duced at low concentrations in patient or control sera. High

levels of autoAbs to IFNl were detected in patients and controls

(Figure 1A). We detected a signiﬁcant increase in autoAbs to

IFNa (66 out of 474 patients) and IFN u (59 out of 474 patients)

in patients with SLE compared with controls (Figures 1B and

1C). Reactivity toward IFN-I subtypes was partially overlapping

as 12% (n = 43) of patients had autoAbs to both IFNa and

IFNu, whereas anti-IFNa or -IFNu single-positive patients

comprised 4% each. Interestingly, the levels of anti-IFN-Abs

signiﬁcantly positively correlated with anti-IFNu-Abs (Figure 1D).

Due to the well-established role of IFNa in promoting SLE path-

ogenesis, we focused our attention on the cohort of patients that

displayed anti-IFN-Abs. Of note, anti-IFN-Abs were predomi-

nantly of the immunoglobulin G1 (IgG1) subclass ( Figure 1E).

Quantiﬁcation of serum IFNa levels with the ultrasensitive Si-

moa method

showed that 93% of patients with SLE had

IFNa serum levels over the detection limit (0.7 fg/mL) compared

with 30% of controls (Figure S1A). The presence of high titers of

anti-IFN-Abs mirrored a signiﬁcant reduction in the levels of

circulating IFNa compared with those who were anti-IFN-Ab

negative and with those with low anti-IFN-Ab titers (Figure 1F).

The capacity of anti-IFN-Abs to neutralize IFNa was assessed

using a reporter-cell-line-based neutralization assay as previ-

ously described.

Serum samples with high anti-IFN-Ab levels

were more efﬁcient in blocking all tested subtypes (IFNa2, -5,

-6, and -8) of IFNa bioactivity in vitro (Figures 1G and S1B).

Only anti-IFN-Abs with a neutralizing capacity of IC50 >100

negatively correlated with serum levels of IFNa (Figure 1H).

To gain mechanistic insight into the capacity of neutral-

izing anti-IFN-Abs to reduce downstream IFN-I signaling, we

compared the IFN-I composite score,

a cumulative measure

of mRNA expression of four individual ISGs, MX1, MCL1, IRF9,

and STAT1 (see STAR Methods), in patients with SLE with and

without anti-IFN-Abs and controls. IFN-I score was signiﬁcantly

Table 1. Demographic and clinical characteristics of patients with SLE with neutralizing or non-neutralizing anti-IFN-Abs, anti-IFN-Ab-

negative patients, and controls

Control (n = 312) Cross-sectional Ab

neg

(n = 428) Cross-sectional Ab

non-neut

(n = 47) Cross-sectional Ab

neut

(n = 28)

Age (range) 66.0 (31–87) 47.0 (17–86) 45.1 (23–73) 47.5 (28–72)

Age at diagnosis (range) – 29.1 (1–75) 29.5 (12–63) 28.4 (8–51)

Gender (female:male) (146:166) (394:34) (42:5) (26:2)

Gender (% female:male) (47.8:53.2) (92:8) (89.4:10.6) (92.9:7.1)

Ethnicity

(% AC/W/SA/EA/O)

(0/100/0/0/0) (17.9/60.9/13.4/4.9/2.8) (38.3/46.8/12.7/2.1/0) (42.8/39.3/10.7/7.1/0)

Treatment (%)

HCQ – 49.4 35.6 39.3

Pred – 50.1 68.9 42.9

MTX – 3.8 6.7 0

MMF – 9.6 22.2 14.3

Aza – 16.2 17.8 4.8

Patients fulﬁlling the revised classiﬁcation criteria for SLE were assessed for disease activity with the British Isles Lupus Assessment Group Index

(BILAG). The BILAG index is a clinical measure of disease that distinguishes activity in nine different organ systems. Each organ system was given

a grade, A, B, C, D, or E, where A was the most active and E the least active. Grades were converted into numerical scores using the BILAG-2004

index, where A = 12, B = 8, C = 1, D = 0, and E = 0. Global BILAG scores were calculated by adding the sum of the values from all organ systems.

Patients with a global score higher than 6 were considered active. The following abbreviations are used: AC, African-Caribbean; W, White; SA, South

Asian; EA, East Asian; O, other; HCQ, hydroxychloroquine; Pred, prednisolone; MTX, methotrexate; MMF, mycophenolate mofetil; Aza, azathioprine.

Reported in this table are all patients measured for anti-IFN-Abs throughout the duration of the study.

2 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

Figure 1. Neutralizing anti-IFN-Abs in patients with SLE inversely correlate with circulating IFNa

(A) Heatmap showing levels (arbitrary units [a.u.]) of anti-cytokine autoantibodies (IFNa pool, IFNu, IFNl pool, IFNb1, Th17 pool, IFNg, IL-pool, and TNF) in 474

patients with SLE and 312 controls measured by luciferase immunoprecipitation system (LIPS) assay.

(B and C) Levels of (B) anti-IFNa (positive cutoff 1.7 a.u.) and (C) anti-IFNu autoantibodies (positive cut-off 2.3 a.u.) in sera from 474 patients with SLE and 312

controls.

(D) Correlation between serum titers of anti-IFNa and anti-IFNu-autoantibodies in autoantibody-positive patients.

(E) IgG subclasses of anti-IFN-Abs represented as luciferase units (LUs) for patients with SLE (n = 59) and controls (n = 6).

(F) Serum IFNa concentration of patients with SLE with high (>100 a.u.), low (<100 a.u.), or negative (<1.9 a.u.) titers of anti-IFN-Abs and controls.

(G) Correlation between IC50 and titer of neutralizing anti-IFN-Abs.

(H) Correlation between serum IFNa concentrations (measured by Simoa assay) and anti-IFNa-autoAb titers for patients with SLE grouped according to

neutralization capacity (neutralizing IC50 > 100, non-neutralizing IC50 < 100).

(legend continued on next page)

Cell Reports Medicine 4, 100894, January 17, 2023 3

Report

OPEN ACCESS

higher in anti-IFN-Ab-negative and non-neutralizing anti-IFN-Ab

patients compared with controls and with patients with neutral-

izing anti-IFN-Abs. The latter displayed an IFN-I score compara-

ble to controls (Figures 1IandS1C). We measured anti-IFN-Ab ti-

ters longitudinally over an average of 10 years from the ﬁrst

sample collection. All patients tested have autoAbs against 12

subtypes of IFNa (IFNa1, -2, -4, -5, -6, -7, -8, -10, -14, -16, -17,

and -21) at high titers (Figures 1J and S1D).

Neutralizing anti-IFN-Abs are a proxy for persistent low

levels of IFNa and are associated with a better clinical

outcome

We next investigated the effect that the presence of neutralizing

anti-IFN-Abs has on disease severity. Patients with at least one

neutralizing Ab against an IFNa subtype displayed signiﬁcantly

lower disease activity (as measured by the British Isles Lupus

Assessment Group [BILAG] global score [GS]) compared with

patients without anti-IFN-Abs in circulation or patients with

non-neutralizing anti-IFN-Abs (Figure 2A). Notably, 5 out of 6 pa-

tients with neutralizing anti-IFN-Abs that had active disease (GS

R 5) at the time of sampling displayed a consistently reduced GS

in the follow-up clinic appointments, suggesting that the gener-

ation of neutralizing anti-IFN-Abs precedes amelioration of dis-

ease (Figure S3A). The analysis of organ involvement is depicted

in Figure S2. Renal, skin, and musculoskeletal involvement was

more common in patients with non-neutralizing Abs than in pa-

tients negative for these Abs.

To understand the stability of the anti-IFN-Abs, we assessed

the kinetics of anti-IFN-Ab production, circulating IFNa levels,

and disease activity in a longitudinal cohort (30 patients with

SLE) over a 10-year period (cohort’s demographics is pre-

sented in Table S2). The presence of high titers of neutralizing

anti-IFN-Abs mirrored a reduction of serum pan-IFNa protein to

undetectable levels. The prolonged presence of neutralizing

anti-IFN-Abs together with a consistently low IFNa concentra-

tion also paralleled a persistent inactive clinical score (Fig-

ure 2B). Patients with non-neutralizing anti-IFN-Abs in circula-

tion present with high levels of serum IFNa and a more

severe disease activity (Figure 2C). We also observed reduced

titers of anti-dsDNA autoAbs in patients with neutralizing anti-

IFN-Abs but no changes in C3 levels between the different

groups (Figures S3B and S3C).

Follow-up analysis of organ involvement showed that both the

negative and non-neutralizing groups experienced more disease

ﬂares in the renal, musculoskeletal, skin, and hematological sys-

tems compared with patients with neutralizing anti-IFN-Abs (Fig-

ure S3D). One individual in the neutralizing anti-IFN-Ab group

maintained a B score in renal activity; however, this patient

had consistently high Ab titers and neutralizing capacity with un-

detectable serum IFNa for the entire duration and displayed

inactive disease in all other organ systems.

The bioactivity of IFNa from the sera of non-neutralizing anti-

IFN-Ab and anti-IFN-Ab-negative patients was similar, con-

ﬁrming that non-neutralizing anti-IFN-Abs do not neutralize

circulating IFNa (Figure S3E). These results suggest that non-

neutralizing anti-IFN-Abs may stabilize circulating IFN a levels

as previously suggested for other cytokines.

34–36

Patients lack-

ing anti-IFN-Abs present active disease over time (Figure 2D).

Neither the titers of anti-IFN-Abs nor IFNa serum levels were

affected by treatment regime (Figures S3F–S3H).

Restored B cell populations in patients with SLE with

neutralizing anti-IFN-Abs

Patients with SLE are known to present with a variety of B cell ab-

normalities, including increased frequencies of immature, DN B

cells and plasmablasts and a decrease in Bregs.

1–3

work by us and others has demonstrated that the level of expo-

sure to IFNa determines immature B cell fate.

5,6,37

Whereas

exposure of immature B cells to low-moderate concentrations

of IFNa simultaneously expand both Bregs and plasmablasts,

high concentrations of IFNa (observed in patients with SLE)

biases B cell differentiation toward pro-inﬂammatory plasma-

blasts and plasma cells.

To evaluate whether the presence of

neutralizing anti-IFN-Abs is associated with a normalization of

the B cell frequencies and their responses, we quantiﬁed

ex vivo B cell subset frequencies in patient groups deﬁned by

the presence or absence of neutralizing and non-neutralizing

anti-IFN-Abs and controls (Table S3). Anti-IFN-Ab-negative pa-

tients showed a signiﬁcant increase in immature, DN (CD27



IgD



) and plasmablast(CD27

IgD



CD38

) B cells and a reduced

frequency of unswitched memory (USM; CD27

IgD

) and class-

switched memory (CD27

IgD



CD38

low

) B cells compared with

controls (Figures 3A and 3B; gating strategy in Figure S4A).

Patients with neutralizing (IC50 > 100) anti-IFN-Abs have

similar B cell subset frequencies to controls except for class-

switched memory (CD27

IgD



CD38

) B cells. In contrast, pa-

tients with non-neutralizing (IC50 < 100) anti-IFN-Abs display

the same degree of altered subset frequencies as anti-IFN-Ab-

negative patients (Figure 3C). We show no differences in

the frequencies of T follicular helper cell (T

) subsets (circulating

[cT

] or activated [aT

]) between patients and controls

(Figures S5A and S5B). No differences were detected in CD4

CXCR5



PD-1

T peripheral helper cells (TPH) frequencies, pre-

viously described to be expanded in patients with SLE and to

be drivers of disease activity

between controls and any group

of patients with SLE (Figure S5C). This supports a direct role of

anti-IFN-Abs in normalizing B cell subset frequencies rather

than indirectly via modiﬁcations to the T

or TPH compartment.

To establish whether B cells from patients with SLE with anti-

IFN-Abs have regained the capacity to differentiate into Bregs

(hereafter deﬁned as IL-10

B cells), we stimulated peripheral

blood mononuclear cells (PBMCs) from patients with SLE and

(I) Interferon score of PBMCs isolated ex vivo from patients with neutralizing (n = 8) or non-neutralizing (n = 16) anti-IFN-Abs, anti-IFN-Ab-negative patients with

SLE (n = 54), and controls (n = 17). Data represented are a cumulative score of the expression of ISGs MX1, MCL1, IRF9, and STAT1 measured by qRT-PCR and

relative to GAPDH.

(J) Representative graph showing the titers of neutralizing anti-IFN-Abs against IFNa subtypes longitudinally in one patient with SLE.

*p < 0.05, **p = 0.01, ****p < 0.0001 by (D) unpaired Student’s t test with Welch’s correction, (E and F) Kruskal-Wallis test with Dunn’s multiple comparison, (G) two-

tailed Spearman correlation, and (I) Mann-Whitney test. Error bars are shown as mean ± SEM.

4 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

controls with CpGC for 72 h to induce IFNa production by plas-

macytoid DCs (pDCs) and IL-10

B cell differentiation, as previ-

ously shown by our group.

There was a signiﬁcant decrease in

IL-10

B cell frequencies in anti-IFNa-autoAb-negative and non-

neutralizing anti-IFN-Ab patients but not in patients with neutral-

izing anti-IFN-Abs compared with controls (Figure 3D).

IFNa-induced immature and plasmablast B cell

expansion is inhibited by IgG from patients with SLE with

neutralizing anti-IFN-Abs

In response to viral infections, pDCs rapidly produce IFNa that

drives B cell maturation into plasma cells producing Abs

against viral antigens.

In view of the recent ﬁndings showing

the detrimental effect of neutralizing anti-IFN-Abs in patients

with COVID-19, it is important to understand the impact of

neutralizing anti-IFN-Abs on ‘‘nascent’’ IFNa produced by chal-

lenged pDCs and how this affects healthy B cell differentiation.

PBMCs from controls were stimulated with CpGC and cultured,

respectively, with puriﬁed total IgG from patients with SLE

with no Abs (negative), with non-neutralizing anti-IFN-Abs,

and with neutralizing anti-IFN-Abs. Healthy allogeneic IgG

was used as a control. An Fc blocking reagent was included

to remove the IgG-mediated activation of FcR-expressing im-

mune cell subsets. Inclusion of the Fc blocking reagent did

not alter frequencies of immature B cells, plasmablasts, or

Blimp1

or IL-10

B cells compared with CpGC stimulation

alone (Figure S5D).

IgG from patients containing neutralizing anti-IFN-Abs signiﬁ-

cantly downregulated ISG expression in cultured CpGC-stimu-

lated control PBMCs, conﬁrming their ability to inhibit IFNa

downstream signaling (Figure 4A). IgG from patients with

neutralizing anti-IFN-Abs reduced the levels of IFNa in culture

supernatants, whereas non-neutralizing anti-IFN-Abs increased

IFNa concentrations (Figure 4B). Control IgG or IgG from patients

with SLE lacking anti-IFN-Abs show no effect.

Addition of control IgG, or IgG from anti-IFN-Ab-negative pa-

tients with SLE, did not impair the CpG-induced expansion of

immature B cells and plasmablasts. IgG isolated from patients

with neutralizing anti-IFN-Abs signiﬁcantly reduced the expan-

sion of immature B cells and plasmablasts, with the latter also

conﬁrmed by a reduced Blimp1 expression, compared with

non-neutralizing anti-IFN-Abs (Figures 4C and 4D). IgG from pa-

tients with non-neutralizing anti-IFN-Abs increased the fre-

quencies of immature B cells and plasmablasts (and Blimp1

B cells), suggesting that these autoAbs stabilize IFNa and

enhance B cell responses to IFNa. Only IgG from patients with

neutralizing anti-IFN-Abs halted the CpGC-driven IL-10

Bcell

expansion, further conﬁrming their neutralization capacity and

the requirement of optimal IFNa levels for Breg differentiation

(Figure 4E).

DISCUSSION

In summary, we report that a subset of patients with SLE harbor

neutralizing anti-IFN-Abs that can modulate B cell responses

and are associated with a better disease outcome. This is in

contrast to patients with non-neutralizing low titers of anti-IFN-

Abs, which appear to stabilize IFNa in the blood and expand

circulating frequencies of DN memory B cells and plasmablasts.

It has been previously shown that CD11c

DN B cells are patho-

genic in SLE. Although we have not speciﬁcally measured this

population, it is interesting that the DN B cells were reduced in

patients with neutralizing anti-IFN-Abs. Future work with a larger

cohort of patients quantifying frequencies of CD11c

Tbet

DN B

cells and their association with the development of neutralizing

versus non-neutralizing anti-IFN-Abs are warranted.

Figure 2. Neutralizing anti-IFN-Abs are longi tudinally stable, neutralize IFNa in vivo, and are associated with inactive disease

(A) Graph shows disease activity as assessed by British Isles Lupus Assessment Group (BILAG) global score (GS) for patients with SLE with neutralizing

(IC50 > 100) (n = 28) and non-neutralizing (IC50 < 100) anti-IFN-Abs (n = 47) and anti-IFN-Ab-negative patients (n = 375).

(B–D) Longitudinal analysis of anti-IFN-Ab titers, serum IFNa levels, and GSs for (B) 11 patients with SLE with neutralizing anti-IFN-Abs, (C) 10 patients with SLE

with non-neutralizing anti-IFN-Abs, and (D) 9 anti-IFN-Ab-negative patients with SLE. Dotted lines at y = 5 indicate the point at which the GS is considered as

active disease.

*p < 0.05 by (A) Kruskal-Wallis test with Dunn’s multiple comparison. Error bars are shown as mean ± SEM.

Cell Reports Medicine 4, 100894, January 17, 2023 5

Report

OPEN ACCESS

The association of non-neutralizing anti-IFN-Abs with high

IFNa concentrations is intriguing. It has been previously sug-

gested that in certain cases, including more recently in patients

with COVID-19,

circulating autoAbs can increase the half-life

of the molecule they bind, possibly through the uptake and

release of immune complexes by the neonatal Fc receptor on

endothelial cells.

41,42

In addition, autoAb binding may change

the conformation of IFNa and lead to more efﬁcient binding to

the receptor.

The cellular source of these anti-IFN-Abs remains unknown.

It is plausible to speculate that anti-IFN-Abs could be pro-

duced either by a pool of memory B cells that, upon IFNa

Figure 3. Patients with SLE with neutralizing anti-IFN-Abs display normalized frequencies of peripheral blood B cell subsets

(A–C) Representative contour plots and graphs shown for patients with SLE with neutralizing anti-IFN-Abs (n = 10) or non-neutralizing anti-IFN-Abs (n = 14), anti-

IFN-Ab-negative patients with SLE (n = 41), and healthy individuals (n = 15). Ex vivo frequencies of (A) immature (Imm; CD24

CD38

) and mature (Mat; CD24

int

CD38

int

) B cells gated within the naive (CD27



IgD

) subset; (B) naive (N; CD27



IgD

IgM

) unswitched memory (USM; CD27

IgD

) and double-negative (DN;

CD27



IgD



) B cells gated within the total CD19

population; and (C) class-switched memory B cells (CSMs) and plasmablasts/plasma cells (PB/PC) gated within

the CD27

IgD



subset. All values are given as the percentage of total CD19

population (gating st rategy in Figure S3A).

(D) Representative contour plots and graphs show frequencies of IL-10

B cells within the total CD19

population following 72 h in vitro CpGC stimulation of

PBMCs isolated from patients with SLE with neutralizing anti-IFN-Abs (n = 7) or non-neutralizing anti-IFN-Abs (n = 12), anti-IFN-Ab-negative patients with SLE

(n = 16), and healthy individuals (n = 13).

*p < 0.05, **p < 0.01, ***p < 0.001 by non-parametric Kruskal-Wallis test with Dunn’s multiple comparison. Error bars are shown as mean ± SEM. Data are

representative of at least 3 independent experiments.

6 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

challenge, such as following infection, induce the production

of anti-IFN-Abs. However, our ﬁndings showing a persistent

presence of autoAbs matching dramatically reduced levels

of IFN-I and clinical score suggest a role for long-lived plasma

cells in the production of these Abs. Due to the reduced dis-

ease severity afforded by the presence of high titers of neutral-

izing anti-IFN-Abs, none of these patients were treated with

rituximab, which would abrogate circulating IFNa-speciﬁc

memory B cells.

Our ﬁndings are relevant in the current COVID-19 pandemic,

where anti-IFN-I-Abs and impaired IFN signaling have been

associated with higher susceptibility for serious illness.

When

administering anti-IFN-I blockade therapy (e.g., anifrolumab, a

human monoclonal Ab to IFN-I subunit 1), measuring levels of

anti-IFN-Abs in patient sera would be clinically more practical

than measuring the IFN-I PBMC gene signature for pre-

screening patients. Anifrolumab has been now approved as a

therapy for patients with SLE with moderate and severe disease.

It would be important to pre-screen patients to establish the

presence and neutralization capacity of anti-IFN-Abs and

exclude these patients from this treatment.

Limitations of the study

The scale of our analysis of B cells/PBMCs from these patients

was limited by restricted sample availability due to the COVID-

19 pandemic.

As discussed, the cellular source of neutralizing and non-

neutralizing anti-IFN-Absremainsto be determined. Unfortunately,

Figure 4. IgG from patients with neutralizing anti-IFN-Abs inhibits healthy B cell responses to IFNa PBMCs from controls were stimulated

with CpGC in the presence of IgG puriﬁed from controls, patients with SLE lacking anti-IFN-Abs, or patients with SLE with non-neutralizing or

neutralizing anti-IFN-Abs

(A) Graphs shows IFN score of control PBMCs following IgG exposure.

(B) Graph showing levels of IFN a in culture supernatants following IgG exposure.

CD38

(Imm), CD24

int

CD38

int

(Mat), CD24

CD38

(Memory [Mem]) B cells, and CD24

lo/

CD38

(PBs).

(D) Histogram and graph show frequencies of Blimp

B cells following culture.

(E) Representative contour plots and graph show frequencies of IL-10

B cells.

*p < 0.05, **p < 0.01 by one-way ANOVA with Tukey’s multiple comparisons test (A and C–E) or Mann-Whitney test (B). Error bars are shown as mean ± SEM. Data

are representative of 2 independent experiments.

Cell Reports Medicine 4, 100894, January 17, 2023 7

Report

OPEN ACCESS

this type of analysis requires a substantial amount of peripheral

blood, which we are unable to obtain both because patients with

SLE are frequently lymphopenic and our ethics only permit us to

draw 25 mL blood per clinic visit.

The pathogenic role of non-neutralizing autoAbs through sta-

bilization of IFNa levels in the circulation was suggested

through indirect evidence; this has yet to be formally proven.

Our study was also unable to discriminate autoAb avidity from

concentration.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY

B Lead contact

B Materials availability

B Data and code availability

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Study population

B Cell and cell lines

d METHOD DETAILS

B PBMC and serum isolation

B Luciferase immunoprecipitation system (LIPS) assay

B Neutralization assay

B IFNa concentration measurement

B RT-qPCR

B Flow Cytometry staining and analysis

B IgG isolation from plasma

d QUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.

xcrm.2022.100894.

ACKNOWLEDGMENTS

This work is funded by a Versus Arthritis UK program grant (21140) to C.M.; the

Versus Arthritis UK Research Award (21786) to C.M. and M.M.; the Academy of

Medical Sciences Springboard Award (SBF006\1165) to M.M.; the European

Regional Development Fund (project no. 2014-2020.4.01.15-0012 and the

Center of Excellence in Genomics [EXCEGEN] framework) to L.H., P.P., and

K.K.; and Estonian Research Council grants PRG1117 to K.K. and PRG377

to P.P. H.F.B. is funded by a UCB BIOPHARMA SPRL/BBSRC PhD Student-

ship (BB/P504725/1). We thank Immunoqure for the provision of monoclonal

Abs (mAbs) for the pan-IFNa assay under an MTA to D.D. D.D. acknowledges

support from the ANR (CE17001002). We thank Drs. Diego Catalan and Chris-

topher Piper for critically reviewing the manuscript. The graphical abstract was

created with BioRender.com.

AUTHOR CONTRIBUTIONS

H.F.B., L.H., and M.M. designed and performed experiments. T.C.R.M. pro-

vided patient and healthy control IgG. K.S. and M.V. assisted with experi-

ments. D.A.I., R.A., C.W., and R.F.G. provided clinical information and exper-

tise. D.D., P.P., and V.B. provided serum IFNa measurements. C.M. and K.K.

designed experiments and conceptualized and supervise d the study.

DECLARATION OF INTERESTS

K.K. and P.P. have ownership of the patent USA20190071499A1.

Received: June 17, 2022

Revised: August 28, 2022

Accepted: December 13, 2022

Published: January 17, 2023

REFERENCES

1. Wei, C., Anolik, J., Cappione, A., Zheng, B., Pugh-Bernard, A., Brooks, J.,

Lee, E.-H., Milner, E.C.B., and Sanz, I. (2007). A new population of cells

lacking expression of CD27 represents a notable component of the B cell

memory compartment in systemic lupus erythematosus. J. Immunol. 178,

6624–6633. https://doi.org/10.4049/jimmunol.178.10.6624.

2. Jacobi, A.M., Reiter, K., Mackay, M., Aranow, C., Hiepe, F., Radbruch, A.,

Hansen, A., Burmester, G.R., Diamond, B., Lipsky, P.E., et al. (2008). Acti-

vated memory B cell subsets correlate with disease activity in systemic

lupus erythematosus: delineation by expression of CD27, IgD, and

CD95. Arthritis Rheum. 58, 1762–1773. https://doi.org/10.1002/art.23498.

3. Jacobi, A.M., Odendahl, M., Reiter, K., Bruns, A., Burmester, G.R., Rad-

bruch, A., Valet, G., Lipsky, P.E., and Do

rner, T. (2003). Correlation be-

tween circulating CD27high plasma cells and disease activity in patients

with systemic lupus erythematosus. Arthritis Rheum. 48, 1332–1342.

https://doi.org/10.1002/art.10949.

4. Capobianchi, M.,R., Uleri, E., Caglioti, C., and Dolei, A. (2015). Type I IFN

family members: similarity, differences and interaction. Cytokine Growth

Factor Rev. 26, 103.

5. Jego, G., Palucka, A.K., Blanck, J.P., Chalouni, C., Pascual, V., and Ban-

chereau, J. (2003). Plasmacytoid dendritic cells induce plasma cell differ-

entiation through type I interferon and interleukin 6. Immunity 19, 225–234 .

https://doi.org/10.1016/S1074-7613(03)00208-5.

6. Menon, M., Blair, P.A., Isenberg, D.A., and Mauri, C. (2016). A regulatory

feedback between plasmacytoid dendritic cells and regulatory B cells is

aberrant in systemic lupus erythematosus. Immunity 44, 683–697.

https://doi.org/10.1016/j.immuni.2016.02.012.

7. Blanco, P., Palucka, A.K., Gill, M., Pascual, V., and Banchereau, J. (2001).

Induction of dendritic cell differentiation by IFN-a in systemic lupus erythe-

matosus. Science 294, 1540–1543. https://doi.org/10.1126/science.

1064890.

8. Santini, S.M., Lapenta, C., Logozzi, M., Parlato, S., Spada, M., Di Pucchio,

T., and Belardelli, F. (2000). Type I interferon as a powerful adjuv ant for

monocyte-derived dendritic cell development and activity in vitro and in

Hu-PBL-SCID mice. J. Exp. Med. 191, 1777–1788. https://doi.org/10.

1084/jem.191.10.1777.

9. Blanco, P., Pitard, V., Viallard, J.F., Taupin, J.L., Pellegrin, J.L., and Mor-

eau, J.F. (2005). Increase in activated CD8+ T lymphocytes expressing

perforin and granzyme B correlates with disease activity in patients with

systemic lupus erythematosus. Arthritis Rheum. 52, 201–211. https://

doi.org/10.1002/art.20745.

10. Yu, C.-F., Peng, W.-M., Oldenburg, J., Hoch, J., Bieber, T., Limmer, A.,

Hartmann, G., Barchet, W., Eis-H

€

ubinger, A.M., and Novak, N. (2010). Hu-

man plasmacytoid dendritic cells support Th17 cell effector function in

response to TLR7 ligation. J. Immunol. 184, 1159–1167. https://doi.org/

10.4049/jimmunol.0901706.

11. Le Bon, A., Durand, V., Kamphuis, E., Thompson, C., Bulfone-Paus, S.,

Rossmann, C., Kalinke, U., and To ugh, D.F. (2006). Direct stimulation of

T cells by type I IFN enhances the CD8 + T cell response during cross-

priming. J. Immunol. 176, 4682–4689. https://doi.org/10.4049/jimmunol.

176.8.4682.

12. Litinskiy, M.B., Nardelli, B., Hilbert, D.M., He, B., Schaffer, A., Casali, P.,

Cerutti, A., and Sciences, G. (2002). DCs induce CD40-independent

8 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

immunoglobulin class switching through BLyS and APRIL. Nat. Immunol.

3, 822–829. https://doi.org/10.1038/ni829.

13. Lood, C., Gullstrand, B., Truedsson, L., Olin, A.I., Alm, G.V., Ro

nnblom, L.,

Sturfelt, G., Eloranta, M.L., and Bengtsson, A.A. (2009). C1q inhibits im-

mune complex-induced interferon-a production in plasmacytoid dendritic

cells. Arthritis Rheum. 60, 3081–3090. https://doi.org/10.1002/art.24852.

14. Wu, J., Wilson, J., He, J., Xiang, L., Schur, P.H., and Mountz, J.D. (1996).

Fas ligand mutation in a patient with systemic lupus erythematosus and

lymphoproliferative disease. J. Clin. Invest. 98, 1107–1113. https://doi.

org/10.1172/JCI118892.

15. Rice, G.I., Rodero, M.P., and Crow, Y.J. (2015). Human disease pheno-

types associated with mutations in TREX1. J. Clin. Immunol. 35,

235–243. https://doi.org/10.1007/s10875-015-0147-3.

16. Wandl, U.B., Nagel-Hiemke, M., May, D., Kreuzfelder, E., Kloke, O.,

Kranzhoff, M., Seeber, S., and Niederle, N. (1992). Lupus-like autoimmune

disease induced by interferon therapy for myeloproliferative disorders.

Clin. Immunol. Immunopathol. 65, 70–74. https://doi.org/10.1016/0090-

1229(92)90250-R.

17. Ho, V., Mclean, A., and Terry, S. (2008). Severe systemic lupus erythema-

tosus induced by antiviral treatment for hepatitis C. J. Clin. Rheumatol. 14,

166–168.

18. Houssiau, F.A., Thanou, A., Mazur, M., Ramiterre, E., Gomez Mora, D.A.,

Misterska-Skora, M., Perich-Campos, R.A., Smakotina, S.A., Cerpa Cruz,

S., Louzir, B., et al. (2020). IFN-a kinoid in systemic lupus erythematosus:

results from a phase IIb, randomised, placebo-controlled study. Ann.

Rheum. Dis. 79, 347–355. https://doi.org/10.1136/annrheumdis -2019-

216379.

19. Furie, R.A., Morand, E.F., Bruce, I.N., Manzi, S., Kalunian, K.C., Vital, E.M.,

Lawrence Ford, T., Gupta, R., Hiepe, F., Santiago, M., et al. (2019). Type I

interferon inhib itor anifrolumab in active systemic lupus erythematosis

(TULIP-1): a randomised, contro lled, phase 3 trial. Lancet Rheumatol. 1,

208–219.

20. Chatham, W.W., Furie, R., Saxena, A., Brohawn, P., Schwetje, E., Abreu,

G., and Tummala, R. (2021). Long-term safety and efﬁcacy of anifrolumab

in adults with systemic lupus erythematosus: results of a phase II open-la-

bel extension study. Arthritis Rheumatol. 73, 816–825. https://doi.org/10.

1002/art.41598.

21. van der Eijk, A.A., Vrolijk, J.M., and Haagmans, B.L. (2006). Antibodies

neutralizing peginterferon alfa during retreatment of hepatitis C. N. Engl.

J. Med. 354, 1323–1324. https://doi.org/10.1056/nejmc052880.

22. Sorensen, P.S., Ross, C., Clemmesen, K.M., Bendtzen, K., Frederiksen,

J.L., Jensen, K., Kristensen, O., Petersen, T., Rasmussen, S., Ravnborg,

M., et al. (2003). Clinical importance of neutralising antibodies against

interferon beta in patients with relapsing-remitting multiple sclerosis. Lan-

cet 362, 1184–1191. https://doi.org/10.1016/S0140-6736(03)14541-2.

23. Meager, A., Visvalingam, K., Peterson, P., Mo

ll, K., Muruma

gi, A., Krohn,

K., Eskelin, P., Perheentupa, J., Husebye, E., Kadota, Y., et al. (2006).

Anti-interferon autoantibodies in autoimmune polyendocrinopathy syn-

drome type 1. PLoS Med. 3 , e289. https://doi.org/10.1371/journal.pmed.

0030289.

24. Kisand, K., Link, M., Wolff, A.S.B., Meager, A., Tserel, L., Org, T., Muru-

gi, A., Uibo, R., Willcox, N., Trebusak Podkrajsek, K., et al. (2008). Inter-

feron autoantibodies associated with AIRE deﬁciency decrease the

expression of IFN-stimulated genes. Blood 112, 2657–2666.

https://doi.

org/10.1182/blood-2008-03-144634.

25. Meager, A., Vincent, A., Newsom-Davis, J., and Willcox, N. (1997). Spon-

taneous neutralising antibodies to interferon- and interleukin-12 in thy-

moma- associated autoimmune disease. Lancet 350, 1596–1597.

26. Gupta, S., Tatouli, I.P., Rosen, L.B., Hasni, S., Alevizos, I., Manna, Z.G.,

Rivera, J., Jiang, C., Siegel, R.M., Holland, S.M., et al. (2016). Distinct func-

tions of autoantibodies against interferon in systemic lupus erythemato-

sus: a comprehensive analysis of anticytokine autoantibodies in common

rheumatic diseases. Arthritis Rheumatol. 68, 1677–1687. https://doi.org/

10.1002/art.39607.

27. Morimoto, A.M., Flesher, D.T., Yang, J., Wolslegel, K., Wang, X., Brady, A.,

Abbas, A.R., Quarmby, V., Wakshull, E., Richardson, B., et al. (2011). As-

sociation of endogenous anti-interferon-a autoantibodies with decreased

interferon-pathway and disease activity in patients with systemic lupus er-

ythematosus. Arthritis Rheum. 63, 2407–2415. https://doi.org/10.1002/

art.30399.

28. Mathian, A., Breillat, P., Dorgham, K., Bastard, P., Charre, C., Lhote, R.,

Quentric, P., Moyon, Q., Mariaggi, A.-A., Mouries-Martin, S., et al.

(2022). Lower disease activity but higher risk of severe COVID-19 and her-

pes zoster in patients with systemic lupus erythematosus with pre-existing

autoantibodies neutralising IFN-a. Ann. Rheum. Dis. 81, 1695–1703.

https://doi.org/10.1136/ard-2022-222549.

29. Bastard, P., Rosen, L.B., Zhang, Q., Michailidis, E., Hoffmann, H.H.,

Zhang, Y., Dorgham, K., Philippot, Q., Rosain, J., Be

ziat, V., et al.

(2020). Autoantibod ies against type I IFNs in patients with life-threatening

COVID-19. Science 370, eabd4585. https://doi.org/10.1126/science.

abd4585.

30. Bastard, P., Michailidis, E., Hoffmann, H., Chbihi, M., Voyer, T., Rosain, J.,

Philippot, Q., Seeleuthner, Y., Gervais, A., Materna, M., et al. (2021). Auto-

antibodies to type I IFNs can underlie adverse reactions to yellow fever live

attenuated vaccine. J. Exp. Med. 218, e20202486.

31. Rodero, M.P., Decalf, J., Bondet, V., Hunt, D., Rice, G.I., Werneke, S.,

McGlasson, S.L., Alyanakian, M.A., Bader-Meunier, B., Barnerias, C.,

et al. (2017). Detection of interferon alpha protein reveals differential levels

and cellular sources in disease. J. Exp. Med. 214, 1547–1555. https://doi.

org/10.1084/jem.20161451.

32. Meyer, S., Woodward, M., Hertel, C., Vlaicu, P., Haque, Y., Ka

rner, J.,

Macagno, A., Onuoha, S.C., Fishman, D., Peterson, H., et al. (2016).

AIRE-deﬁcient patients harbor unique high-afﬁnity disease-ameliorating

autoantibodies. Cell 166, 582–595. https://doi.org/10.1016/j.cell.2016.

06.024.

33. Kirou, K.A., Lee, C., George, S., Louca, K., Papagiannis, I.G., Peterson,

M.G.E., Ly, N., Woodward, R.N., Fry, K.E., Lau, A.Y.H., et al. (2004). Coor-

dinate overexpression of interferon-a-induced genes in systemic lupus er-

ythematosus. Arthritis Rheum. 50, 3958–3967. https://doi.org/10.1002/

art.20798.

34. K a

rner, J., P ihlap, M., Ranki, A., Krohn, K., Trebusak Podkrajsek, K.,

Bratanic, N., Battelino, T., Willcox, N ., Peterson, P., and Kisand, K.

(2016). IL-6-speciﬁc autoantibod ies among APECED an d thymoma pa-

tients. Immun. Inﬂamm. Dis. 4, 235–243. https://doi.or g/10.1002/

iid3.109.

35. Finkelman, F.D., Madden, K.B., Morris, S.C., Holmes, J.M., Boiani, N., Ka-

tona, I.M., and Maliszewski, C.R. (1993). Anti-cytokine antibodies as car-

rier proteins. Prolongation of in vivo effects of exogenous cytokines by in-

jection of cytokine-anti-cytokine antibody complexes. J. Immunol. 151,

1235–1244.

36. Spangler, J.B., Tomala, J., Luca, V.C., Ju de, K.M., Dong , S., Ring, A.M.,

Votavova, P., Pepper, M., Kovar, M., and Garcia, K.C. (2015). Antibodies

to interleukin-2 elicit selective T cell subs et potentiation through distinct

conformational mechanisms. Immunity 42, 815–825. https://doi.org/10.

1016/j.immuni.2015.04.015.

37. Liu, M., Guo, Q., Wu, C., Sterlin, D., Goswami, S., Zhang, Y., Li, T., Bao, C.,

Shen, N., Fu, Q., et al. (2019). Type I interferons promote the survival and

proinﬂammatory properties of transitional B cells in systemic lupus erythe-

matosus patients. Cell. Mol. Immunol. 16, 367–379. https://doi.org/10.

1038/s41423-018-0010-6.

38. Bocharniko v, A.v., Keegan, J., Wacleche, V.S., Cao, Y., Fonseka, C.Y.,

Wang, G., Muise, E.S., Zhang, K.X., Arazi, A., Keras, G., et al. (2019).

PD-1hiCXCR5- T peripheral helper cells promote B cell responses in lupus

via MAF and IL-21. JCI Insight 4, e130062. https://doi.org/10.1172/jci.

insight.130062.

39. Menon, M., Blair, P.A., Isenberg, D.A., and Mauri, C. (2016). A regulatory

feedback between plasmacytoid dendritic cells and regulatory B cells is

Cell Reports Medicine 4, 100894, January 17, 2023 9

Report

OPEN ACCESS

aberrant in systemic lupus erythematosus. Immunity 44, 683–697. https://

doi.org/10.1016/j.immuni.2016.02.012.

40. Wang, E.Y., Mao, T., Klein, J., Dai, Y., Huck, J.D., Liu, F., Zheng, S., Zhou,

T., Israelow, B., Wong, P., et al. (2020). Diverse functiona l autoantibodies

in patients with COVID-19. Preprint at medRxiv. https://doi.org/10.1101/

2020.12.10.20247205.

41. Andersen, J.T., Dalhus, B., Viuff, D., Ravn, B.T., Gunnarsen, K.S., Plum-

ridge, A., Bunting, K., Antunes, F., Williamson, R., Athwal, S., et al.

(2014). Extending serum half-life of albumin by engineering neonat al Fc re-

ceptor (FcRn) binding. J. Biol. Chem. 289, 13492–13502. https://doi.org/

10.1074/jbc.M114.549832.

42. Rosenblum, M.G., Unger, B.W., Gutterman, J.U., Hersh, E.M., David,

G.S., and Frincke, J.M. (1985). Modiﬁcation of human leukocyte inter-

feron pharmacology with a monoclonal antibody. Cancer Res. 45,

2421–2424.

43. Hochberg , M.C. (1997). Updating the American College of Rheumatology

revised criteria for the classiﬁcation of systemic lupus erythematosus.

Arthritis Rheum. 40, 1725. https://doi.org/10.1002/art.1780400928.

44. Tan, E.M., Cohen, A.S., Fries, J.F., Masi, A.T., Mcshane, D.J., Rothﬁeld,

N.F., Schaller, J.G., Talal, N., and Winchester, R.J. (1982). The 1982

revised criteria for the classiﬁcation of systemic lupus erythematosus.

Arthritis Rheum. 25, 1271–1277. https://doi.org/10.1002/art.1780251101.

45. Yee, C.S., Cresswell, L., Farewell, V., Rahman, A., Teh, L.S., Grifﬁths, B.,

Bruce, I.N., Ahmad, Y., Prabu, A., Akil, M., et al. (2010). Numerical scoring

for the BILAG-2004 index. Rheumatology 49, 1665–1669. https://doi.org/

10.1093/rheumatology/keq026.

46. Gordon, C., Amissah-Arthur, M.B., Gayed, M., Brown, S., Bruce, I.N.,

D’Cruz, D., Empson, B., Grifﬁths, B., Jayne, D., Khamashta, M., et al.

(2018). The British Society for Rheumatology guideline for the manage-

ment of systemic lupus erythematosus in adults. Rheumatology 57,

e1–e45. https://doi.org/10.1093/rheumatology/kex286.

10 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Anti-pan-IFNa (capture), 8H1 clone ImmunoQure N/A

Anti-pan-IFNa (detection), 12H15 clone ImmunoQure N/A

Biotin mouse anti-Human IgG1 BD Pharmingen Cat# 555869; RRID:AB_396187

Biotin Mouse anti-human IgG2 BD Pharmingen Cat# 555874; RRID:AB_396190

Biotin Mouse anti-Human IgG4 BD Pharmingen Cat# 555882; RRID:AB_396194

Monoclonal anti-Human IgG3-Biotin Sigma Aldrich Cat# B3523-2ML; RRID:AB_258549

CD19 BV785, Clone HIB19 Biolegend Cat# 363028; RRID:AB_2564257

CD24 APCeFluor780, Clone SN3 A5-2H10 ThermoFisher Scientiﬁc Cat# 47-0247-42; RRID:AB_10735091

CD38 PerCPeFluor710, Clone HB7 ThermoFisher Scientiﬁc Cat# 46-0388-42; RRID:AB_1834399

CD27 PE/Cy7, Clone M-T271 Biolegend Cat# 356412; RRID:AB_2562258

IgD BV605, Clone IA6-2 Biolegend Cat# 348232; RRID:AB_2563337

IL-10 APC, Clone JES5-16E3 BD Pharmingen Cat# 17-7101-82; RRID:AB_469502

Blimp1 Alexa Fluor 488, Clone 646702 Biotechne Cat# IC36081G; RRID:AB_11129439

CD3 Alexa Fluor 488, Clone UCHT1 Biolegend Cat# 300415; RRID:AB_389310

CD4 PE/Dazzle595, Clone A161A1 Biolegend Cat# 357412; RRID:AB_2565664

CXCR5 BV421, Clone J252D4 Biolegend Cat# 356920; RRID:AB_2562303

CCR7 BV785, Clone G043H7 Biolegend Cat# 353230; RRID:AB_2563630

ICOS PE/Cy7, Clone 7E.17G9 Biolegend Cat# 117422; RRID:AB_2860637

PD-1 BUV737, Clone EH12.1 BD PharMingen Cat# 612792; RRID:AB_2870119

Biological samples

Human serum from healthy controls and SLE patient s University College London

Hospital, London UK,

Tartu, Estonia.

N/A

Primary human peripheral blood mononuclear cells

from healthy controls and SLE patients

University College London

Hospital/UCL, London, UK.

N/A

Chemicals, peptides, and recombinant proteins

Recombinant human IFN-a2 Miltenyi Biotech Cat# 130-093-874

Human IFN-Alpha Sampler Set PBL Assay Science Cat# 11002

Nano-Glo luciferase assay reagent Promega Cat# N1110

QUANTI-Blue colorimetric enzyme assay InvivoGen Cat# rep-gbs

CpGC ODN 2395 Invivogen Cat# tlrl-2395

Phorbol-12-myristate-13 acetate (PMA) Sigma Aldrich Cat# 79346

Ionomycin Sigma Aldrich Cat# I9657

Brefeldin A Sigma Aldrich Cat# B5936

Critical commercial assays

PicoPure

(TM)

RNA Isolation Kit ThermoFisher Scientiﬁc Cat# KIT0204

iScript

(TM)

cDNA Synthesis Kit BioRad Cat# 1708891

(TM)

SYBR

(R)

Green Supermix BioRad Cat# 1708882

RNAse-Free DNase Set QIAGEN Cat# 79254

Human Interferon Alpha 2 ELISA Kit Abcam ab233622

Multi-IFN-Alpha subtype quantiﬁcation Digital ELISA kit (Simoa) Quanterix Beta-version

Experimental models: Cell lines

HEK293 ATCC Cat # CRL-1573; RRID:CVCL_0045

HEK-Blue IFN-a/b InvivoGen Cat# hkb-ifnab; RRID:CVCL_KT26

(Continued on next page)

Cell Reports Medicine 4, 100894, January 17, 2023 e1

Report

OPEN ACCESS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the lead contact, Professor

Claudia Mauri (c.mauri@ucl.ac.uk).

Materials availability

This study did not generate new unique reagents.

Data and code availability

d Data reported in this paper will be shared by the lead contact upon request.

d This paper does not report original code.

d Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon

request.

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

Oligonucleotides

Hs_IRF9_1_SG QuantiTect Primer Assay QIAGEN Cat# 249900; GeneGlobe ID: QT00001113

Hs_MCL1_1_SG QuantiTect Primer Assay QIAGEN Cat# 249900; GeneGlobe ID: QT00094122

STAT1 Quantitect primer pair QIAGEN Cat# 249900; GeneGlobe ID: QT00074123

MX1 custom primer pair ThermoFisher Scientiﬁc Sequences provided in methods

GAPDH custom primer pair ThermoFisher Scientiﬁc Sequences described in methods

Recombinant DNA

pPK-CMV-F4 fusion vector PromoCell N/A

Software and algorithms

GraphPad Prism 9 Graphpad Software http://www.graphpad.com

Flowjo v.10 Flowjo, LLC https://ﬂowjo.com

RStudio v 1db809b8 RStudio, PBC https://www.rstudio.com

Other

RPMI-1640 media Sigma Aldrich Cat# R8658

DMEM media Lonza Cat# 12-614F

Fetal calf serum (FCS) Biosera Cat# FB1001/500

Penicillin/Streptomycin Sigma Aldrich Cat# P0781

Antibiotic/Antimycotic Mix Corning Cat# 30-004-CI

Blasticidin InvivoGen Cat# anti-bl-05

Zeocin InvivoGen Cat# ant-zn-05

Trypsin Corning Cat# 25-052-CI

Lipofectamine Invitrogen Cat# 11668-019

OptiMem Gibco Cat# 31985-062

Protein G Agarose High Flow Resin Exalpha Biologicals Cat# COP28

Streptavidin Agarose Beads NovaGen Cat# 69203-3

FcR Blocking Reagent, human Miltenyi Biotec Cat# 130-059-901

eBioscience Intracellular Fixation and Permeabilization buffer set ThermoFisher Scientiﬁc Cat# 88-8824-00

LIVE/DEAD

(TM)

Fixable Blue Dead Cell Stain Kit ThermoFisher Scientiﬁc Cat# L23105

Protein G FF column (1mL) Generon Cat# NB-45-00,048-1-1

Amicon-15 (50kDa NWCO) Merck Cat# UFC505096

Pierce(TM) High Capacity Endotoxin Removal Spin Columns,

0.5mL

ThermoFisher Scientiﬁc Cat# 88276

Pierce(TM) BCA Protein Assay Kit ThermoFisher Scientiﬁc Cat# 23225

e2 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Study population

Blood samplesfor PBMCand serum isolation were collected from SLEpatients attending the University College London Hospital (UCLH)

rheumatology clinic, and from healthy volunteers following informed consent. Ethical approval was obtained from the UCLH Health Ser-

vice ethical committee, under REC reference no. 14/SC/1200. Sample storage complied with requirements of the Data Protection

Act 1998.

The study was designed in a cross-sectional manner. During the period 2009–2020, 501 patients were recruited at University

College London Hospital (UCLH) rheumatology clinic. All patients had to have a diagnosis of SLE satisfying at least 4 of the 11 Amer-

ican College of Rheumatology classiﬁcation criteria and updated in 1997, with a disease duration of R6 months.

43,44

Patients were

positive for antinuclear antibody (ANA or anti-double-stranded DNA (dsDNA) antibodies.

Exclusion criteria were an age under 18, history of treatment with rituximab, participation in any interventional trial and pregnancy.

Patients with severe CNS lupus, congestive heart failure, a history of cancer, severe glomerulonephritis, a history of recurrent or

active infections such as HIV, tuberculosis, hepatitis B/C viruses and a history of demyelinating disease, for example, multiple scle-

rosis or optic neuritis, were also excluded.

All participants underwent a structured examination by a rheumatologist. BILAG SLE criteria were recorded.

Disease duration

was deﬁned as the time (years) from the ﬁrst point at which an SLE diagnosis was documented in the patient records, until inclusion

into this cohort. Disease activity was assessed by the British Isles Lupus Assessment Group (BILAG), a standardized disease activity

assessment. Blood tests are performed as part of routine clinic visits and include: anti-dsDNA (double stranded DNA) autoantibody

titers, complement C3 levels, complete blood counts, urea/electrolytes/serum creatinine, leukocyturia and haematuria, and a dip

stick test for protein with a protein:creatinine ratio requested if + or more is recorded. Fever was deﬁned as a body temperature above

38.5



C, weight loss as a loss of at least 5% of body weight, and cytopenia as leukopenia <3 G/L or thrombocytopenia <100 G/L.

Leukopenia related to drugs or benign ethnic causes were not scored in the BILAG.

To provide numerical scores, we used a previous weighting system that assigned a score of 9 to active manifestations (grade

A in the BILAG), 3 to grade B manifestations, 1 to grade C manifestations, and 0 to grade D and E manifestations. We used the

sum of these sc ores as a summary index (possible range 0–72).

Low lupus disease activity was deﬁned as a BILAG global

score of %5 with no activity in major organ systems and no hemolytic anemia or gastrointestinal activity, without new lupus dis-

ease activity compared with the previous assessment, and with corticosteroid treatment up to 7.5 mg/day of prednisone (treat-

ment with an immunosuppressant and/or hydroxychloroquine (HCQ) were allowed).

Inthecaseofmultipleserumsamplesat

different dates for the same patient, only the oldest one was included and established as day 0. The kinetics of anti-IFN-a-a uto-

antibody levels over time were determined in all the available serum samples of patients who tested positive for anti-IFN-Ab

more than once.

Demographics, clinical characteristics, routine laboratory testing and therapeutic regimen (reported in Tables 1, S2 and S3) were

collected from electronical medical ﬁles of the visit to the clinic recorded on the day blood was drawn (Day 0). Healthy controls from

UCLH and UCL were enrolled after informed consent.

Cell and cell lines

Primary cells

Prior to experiments, PBMCs from healthy controls and SLE patients were stored in liquid nitrogen in cryovials containing 10% DMSO

and 90% fetal calf serum (FCS) and were thawed in warm RPMI 1640 (Sigma-Aldrich) supplemented with 10% FCS and 100 IU/mg peni-

cillin/streptomycin (Sigma-Aldrich). For primary cell cultures, PBMCs were seeded in 96-well plates at a density of 5 3 10

cells/mL in

RPMI 1640 supplemented with 10% FCS and 100 IU/mg penicillin/streptomycin. PBMCs were stimulated with 1mM CpGC ODN

2395 (InvivoGen), then incubated for 72 hrs at 37



C and 5% CO

. For IgG cultures, PBMCs from healthy donors were cultured at

5 3 10

cells/mL with 1mM CpGC, sodium azide-free Fc blocking reagent (Miltenyi) and 200 mg/mL IgG isolated from healthy donors

or SLE patients.

Cell lines

HEK293 cells were thawed and plated in DMEM (Lonza) containing 10% FCS and Antibiotic/Antimycotic mix (Corning) into 10mL

tissue culture plates. Cells were incubated at 37



C and 5% CO

for 72h. Cells were washed with PBS and detached with warm trypsin

(Corning) for 1 min. Trypsin was inactivated with the medium and cells pelleted, then seeded at 250,000 cells per 3mL well of a 6 well

plate in DMEM containing 10% FCS and Antibiotic/Antimycotic mix. Following overnight incubation at 37



C5%CO

cells were trans-

fected with 4mg DNA, 8mL lipofectamine (Invitrogen) and 250mL OptiMem reduced serum media (Gibco).

HEK-Blue cells were thawed and plated in DMEM containing 10% heat-inactivated FCS and Antibiotic/Antimycotic mix in 10mL

culture plates. Cells were incubated at 37



C and 5% CO

and maintained and subcultured in growth medium supplemented with

30 m g/mL blasticidin and 100 mg/mL zeocin (Invitrogen). Cells were passaged upon reaching a 70–80% conﬂuency.

Cell Reports Medicine 4, 100894, January 17, 2023 e3

Report

OPEN ACCESS

METHOD DETAILS

PBMC and serum isolation

A total of 50mL whole peripheral blood was collected from an individual patient or healthy donor for PBMC isolation using Ficoll-

based density gradient centrifugation. A total of 10mL whole peripheral blood was collected into serum-separator (SST) tubes, centri-

fuged for 10 min at 1200 g at RT and serum decanted.

Luciferase immunoprecipitation system (LIPS) assay

LIPS was performed as previously described.

Brieﬂy, different IFNa subtype and cytokine sequences were cloned into modiﬁed

pPK-CMV-F4 fusion vector (PromoCell GmbH, Germany) where Fireﬂy luciferase was substituted in the plasmid for NanoLuc lucif-

erase (Promega, USA). Cloned constructs were transfected into HEK293 cells (ATCC), and after 48h tissue culture media containing

fusion proteins were collected and stored at 20



CC. IgG from the serum samples was captured onto Protein G Agarose beads

(Exalpha Biologicals, USA) at room temperature for 1h in 96-well microﬁlter plate (Merck Millipore, Germany). Antigens were added

to microﬁlter plate at 1 3 10

luminescence units (LU) per well and incubated at room temperature for 1h. After washing the plate with

vacuum system, Nano-Glo Luciferase Assay Reagent was added (Promega, USA). Luminescence intensity was measured by

VICTOR X Multilabel Plate Reader (PerkinElmer Life Sciences, USA). The results were expressed as arbitrary units (AU) representing

the percent of signal intensity from a positive control sample. Positve negative discrimination level was calculated as mean plus 3 SD

from 1% trimmed values of healthy controls.

For the detection of IgG subclass-speciﬁcity, serum samples were incubated with fusion protein solutions (10

LU per well) over-

night at +4



C. Next day, agarose beads bound with streptavidin (Novagen, USA) were incubated with biotin-conjugated human sub-

class-speciﬁc antibodies (anti-IgG

, anti-IgG

from BD Pharmingen, USA; anti-IgG

from Sigma-Aldrich, USA) in microﬁlter

plates for 1 h at room temperature. Overnight incubated serum samples with fusion protein solutions were added to microﬁlter plate

and incubated at room temperature for 2h. Microﬁlter plates were washed, and luminescence intensity measured as above. The re-

sults were expressed as luminescence units (LU).

Neutralization assay

Type I interferon neutralizing capacity was measured by using a reporter cell line HEK-Blue IFN-a/b (InvivoGen, USA) as previously

described.

The cells were grown in DMEM (Lonza, Switzerland) with heat-inactivated 10% FBS, 30 g/mL Blasticidin (InvivoGen,

USA) and 100 g/mL Zeocin (InvivoGen, USA). IFN-a2 was used at concentration 25 U/mL (Miltenyi Biotech, Germany). Serial dilutions

were made to ﬁnd the optimal dilution for other IFN-a subtypes (IFN-a1, IFN- a4, IFN-a5, IFN-a6, IFN-a7, IFN-a8, IFN-a10, IFN-a14,

IFN-a16, IFN-a17, IFN-a21 from PBL Assay Science, USA). The dilution that induced approximately the same alkaline phosphatase

(AP) concentration as IFN-a2 25 U/mL was selected for further neutralization assays.

3-fold serially diluted serum samples were co-incubated with interferons for 2h at 37



C, 5% CO

.10

IFN-a-HEK-Blue cells were

added to microtiter plate wells and incubated 20-24h at 37



C, 5% CO

. QUANTI-Blue (InvivoGen, USA) colorimetric enzyme assay

was used to determine AP activity in overnight supernatants. Optical density (OD) was measured at 620 nm with Multiscan MCC/340

ELISA reader (Labsystems, USA). Neutralization activity was expressed as IC50, which was calculated from the dose-response

curves and represents the serum dilution at which the IFN bioactivity was reduced to half of its maximum.

IFNa concentration measurement

Simoa digital ELISA was performed to measure IFNa concentration in patient serum. Patient samples were measured either with a

homebrew assay previously described

with the speciﬁc assay details below, or with a prototype multi-IFN-a subtype assay (Quan-

terix) that utilises the same mAbs. Two IFN a speciﬁc antibodies (cloned from APECED patients) described previously

were used.

The 8H1 antibody clone was used as a capture antibody after coating on paramagnetic beads (0.3 mg/mL), and the 12H5 was bio-

tinylated (biotin/antibody ratio = 30/1) and used as the detector. The results are expressed in fg/mL, with a detection limit of 0.7 fg/mL.

IFNa concentrations in cell culture supernatants were quantiﬁed using a human interferon alpha 2 ELISA Kit (Abcam).

RT-qPCR

Total RNA was extracted from total PBMCs using the Arcturus PicoPure kit (ThermoFisher) and RNase-Free DNase Set (Qiagen) as

per manufacturer’s instructions. RNA was reverse transcribed to cDNA using the iScript cDNA synthesis kit (Bio-Rad) RT-qPCR was

performed on cDNA samples using the iQ SYBR Green Supermix kit (Bio-Rad) according to manufacturer’s instructions. PCR primers

used are as follows; MCL1, IRF9, STAT1 (QIAGEN), MX1 (forward, 5

CACCATTCCAAGGAGGTGCACG, reverse, 5

AGTTTCAGCAC

CAGCGGGGCA) and GAPDH (forward, 5

CGCTCTCTGCTCCTCCTGTT, reverse 5

GCAAATGAGCCCCAGCCTTCTC). For inter-

feron scores, ISG relative expression values were summed and score calculated as the number of standard deviations (of summed

values from healthy donors; SD(HD)) above the mean of summed healthy donor values; MEAN(HD). Cut-off values were calculated as

the MEAN(HD) + 2SD(HD).

Interferon score =

fð

SUMðISIG rel:xpÞÞ  MEAN ðHDÞg

SD ðHDÞ

e4 Cell Reports Medicine 4, 100894, January 17, 2023

Report

OPEN ACCESS

Flow Cytometry staining and analysis

PBMCs were stained at a maximal concentration of 5 3 10

cells/mL in staining buffer in the dark (PBS, 2% FCS, 1mM EDTA) or as

indicated below. For exclusion of dead cells from analysis, cells were incubated in the dark for 20 min with 1:500 Live/Dead Fixable

Blue Dead Cell Stain Kit (ThermoFisher) at room temperature. Cell surface markers were stained with the following directly conju-

gated antibodies from BioLegend: CD19 BV785 (HIB19), IgD BV605 (IA6-2), CD27 PE/Dazzle 594 (M-T271). CD24 APCeFluor780

(SN3 A5-2H10) and CD38 PerCPeFluor710 (HB7) were purchased from eBioscience. T

staining was performed using the following

directly conjugated antibodies; CD3 Alexa Fluor 488 (BioLegend, UCHT1), CD4 PE/Dazzle594 (BioLegend, A161A1), CXCR5 BV421

(BioLegend, J252D4), CCR7 BV785 (BioLegend, G043H7), ICOS PE/Cy7 (BioLegend, 2D3), and PD-1 BUV737 (BD, EH12.1). For

multi-colour ﬂow cytometric surface marker analysis cells were stained for 30 min in the dark at 4



C. Cells were incubated for

10 min at 4



C in ﬁxation buffer containing formaldehyde (eBioscience).

For intracellular cytokine staining of cultured cells, cells were stimulated with PMA (50 ng/mL), ionomycin (250 ng/mL) and brefeldin

A (5 mg/mL) for the ﬁnal 5 h of culture. Surface markers and dead cells were stained as previously described. Following ﬁxation cells

were permeabilised (eBioscience) and incubated with IL-10 APC (BD, JES5-16E3), Blimp1 Alexa Fluor 488 (R&D systems, 646,702)

for 40 min in the dark at 4



C. Cells were acquired using a Digital LSR II ﬂow cytometer (Becton Dickinson).

IgG isolation from plasma

IgG was puriﬁed by afﬁnity chromatography on an AKTA Start (GE Healthcare) using a Protein G column. Protein G column (1mL,

Generon) was washed with 5 column volumes (CV) of elution buffer (0.1M Glycine, pH 2.3) before equilibration with 5 CV of binding

buffer (100mM sodium phosphate, 140mM sodium chloride, pH 7.2. Plasma (500mL) was thawed at room temperature and diluted 1:1

with binding buffer and injected into a 1mL loop. Protein was injected manually before washing with 5 CV binding buffer and elution

across 5mL elution buffer by isocratic wash. Eluted protein was neutralized using 100mL of Tris per 1mL elution buffer. Samples were

then dialyzed using a 50kDa cut-off centrifugal concentrator (Millipore). Samples were centrifuged at 3500xg for 12 min before addi-

tion of endotoxin-free PBS to a total of 5mL twice. Sample were then quantiﬁed by BCA (Pierce) and endotoxin removed by a column

method (Pierce high-capacity endotoxin removal columns). Columns were regenerated with 0.2M sodium hydroxide in 95% ethanol

for 1 h at room temperature (5CV), then washed with 2M sodium chloride followed by endotoxin-free water (5CV). Columns were

equilibrated with endotoxin-free PBS (5CV) and samples applied. Protein was eluted using endotoxin-free PBS and aliquoted to

quantify remaining IgG using the Nanodrop system (Pierce).

QUANTIFICATION AND STATISTICAL ANALYSIS

Flow cytometric data were analyzed with FlowJo software v.10.4.1 (TreeStar). Statistical analysis was performed with GraphPad

Prism (La Jolla, USA), using unpaired t tests or non-parametric analysis using the Kruskal-Wallis test with Dunn’s multiple comparison

test for multiple comparisons, or one-way ANOVA for data passing Shapiro-Wilk normality tests. Correlations were assessed with

non-parametric Spearman correlation coefﬁcient. A p value of <0.05 was considered as signiﬁcant. ns: not signiﬁcant, *p < 0.05,

**p < 0.01, ***p < 0.001, ****p < 0.0001.

Cell Reports Medicine 4, 100894, January 17, 2023 e5

Report

OPEN ACCESS

Can you speculate on the mechanisms that might govern whether or not a patient produces sufficient anti-IFNa to effectively neutralise IFNa? Are all neutralizing IFNalpha Ab sub-types created equally? Do you think having antibodies to all 12 sub-types is critical, or are some more important than others?

Comments

Products

Project